LOCUS       LK021130             3119695 bp    DNA     circular BCT 04-FEB-2016
DEFINITION  Vibrio anguillarum chromosome 1, strain NB10, complete sequence.
VERSION     LK021130.1
DBLINK      BioProject:PRJEB5701
KEYWORDS    complete genome; complete replicon.
SOURCE      Vibrio anguillarum
  ORGANISM  Vibrio anguillarum
            Bacteria; Proteobacteria; Gammaproteobacteria; Vibrionales;
            Vibrionaceae; Vibrio.
REFERENCE   1  (bases 1 to 3119695)
  AUTHORS   Holm K.
  JOURNAL   Submitted (26-MAR-2014) to the INSDC. Norstruct, Dept of Chemistry,
            University of Tromso, Science Park 3, NO-9037 Tromso, NORWAY.
  AUTHORS   Holm K.O., Nilsson K., Hjerde E., Willassen N.P., Milton D.L.
  TITLE     Complete genome sequence of Vibrio anguillarum strain NB10, a
            virulent isolate from the Gulf of Bothnia
  JOURNAL   Stand Genomic Sci 10, 60-60(2015).
   PUBMED   26380645
FEATURES             Location/Qualifiers
     source          1..3119695
                     /organism="Vibrio anguillarum"
                     /host="Rainbow trout"
                     /mol_type="genomic DNA"
                     /country="Sweden:Baltic Sea, Norrbyn Umeaa"
                     /isolation_source="clinical isolate, Rainbow trout"
     rep_origin      complement(1..367)
                     /gene="oriC1va 5'-end"
                     /note="OriC1va, 5' end (481nt=N+C parts); situated between
                     mioC-gidA; harbours 9 DAM-methylase/GATC-sites (Vchol: has
                     12-14, cfr Vchol AY034431 and AY211526 in Saha et
                     al,2004). DAM methylase (DNA adenine methylase) is an
                     enzyme that adds a methyl group to the adenine of the
                     sequence 5'-GATC-3' in newly synthesized DNA. Immediately
                     after DNA synthesis, the daughter strand remains
                     unmethylated for a short time."
     regulatory      1..12
                     /note="AT-cluster, in OriC1 (cfr Saha et al, 2004; also
                     ref in Rajewska et al, 2012)"
     regulatory      complement(9..20)
                     /note="GATC sequence, in OriC1 (occuring 1x in chr1)"
     regulatory      13..24
                     /note="GATC L-sequence, in OriC1 (according to Saha et
                     al,2004; ref in Rajewska et al, 2012)"
     regulatory      complement(21..32)
                     /note="GATC sequence, in OriC1 (occuring 1x in chr1)"
     regulatory      25..36
                     /note="GATC M-sequence, in OriC1 (according to Saha et
                     al,2004; ref in Rajewska et al, 2012)"
     regulatory      complement(33..44)
                     /note="GATC sequence, in OriC1 (occuring 2x in chr1)"
     regulatory      37..49
                     /note="GATC R-sequence, in OriC1 (according to Saha et
                     al,2004; ref in Rajewska et al, 2012)"
     regulatory      complement(46..57)
                     /note="GATC sequence, in OriC1 (occuring 1x in chr1)"
     regulatory      63..71
                     /note="R1-sequence, DnaA-box in OriC1 (according to Saha
                     et al, 2004)"
     regulatory      complement(63..71)
                     /note="R2'-sequence (rev): TTATCCACA; DnaA-box in OriC1
                     (according to Saha et al, 2004)"
     regulatory      complement(86..97)
                     /note="GATC sequence, in OriC1 (occuring 1x in chr1)"
     regulatory      complement(104..115)
                     /note="GATC sequence, in OriC1 (occuring 1x in chr1):
     misc_binding    108..119
                     /note="putative binding site for E.coli integration host
                     factor homologue (IHF-homologue)"
     regulatory      complement(117..128)
                     /note="GATC sequence, in OriC1 (occuring 1x in chr1):
     regulatory      118..126
                     /note="M-sequence, DnaA-box in OriC1 (according to Saha et
                     al, 2004)"
     regulatory      complement(128..139)
                     /note="GATC sequence, in OriC1 (occuring 1x in chr1):
     regulatory      complement(150..161)
                     /note="GATC sequence, in OriC1 (occuring 1x in chr1)"
     regulatory      169..177
                     /note="R2-sequence, DnaA-box in OriC1 (according to Saha
                     et al, 2004)"
     regulatory      complement(169..177)
                     /note="R1-like sequence: TGTGTATAA; cfr also M'-seq:
                     TGTGATCAA, DnaA-box in OriC1 (according to Saha et
     rep_origin      complement(192..251)
                     /note="Starting seq as compared to vchol-sps
                     (N-blast/alignments) .. continues downstream"
     regulatory      203..211
                     /note="R3-sequence, DnaA-box in OriC1 (according to Saha
                     et al, 2004)"
     regulatory      complement(211..219)
                     /note="rev-seq(149-)=acctatagt; versus promoter at pos.
     regulatory      complement(234..239)
                     /note="rev-seq(129-)=atgctg; versus promoter at pos. 164"
     regulatory      242..250
                     /note="R4-sequence, DnaA-box in OriC1 (according to Saha
                     et al, 2004)"
     regulatory      complement(242..250)
                     /note="R1'-sequence (rev): TGTGTATAA; cfr also M'-seq:
                     TGTGATCAA, DnaA-box in OriC1 (according to Saha et
     regulatory      301..309
                     /note="R4-sequence, DnaA-box in OriC1 (according to Saha
                     et al, 2004)"
     regulatory      complement(301..309)
                     /note="R1-like sequence (rev): TGTGTATAA; cfr also M'-seq:
                     TGTGATCAA, DnaA-box in OriC1 (according to Saha et
     CDS             complement(368..802)
                     /product="protein MioC homolog"
                     /note="user locus_tag: VANGcI0001c"
                     /note="Similar to Vibrio cholerae mioc
                     orderedlocusnames=vc_0002 UniProt:Protein (144 aa) fasta
                     scores: E()=2.6e-48, 79.2% id in 144 aa, and to Vibrio
                     cholerae serotype O1 (strain ATCC 39315/El Tor Inaba
                     N16961) mioc orderedlocusnames=vc_0002
                     UniProt:uniprot_sprot_bacteria (144 aa) fasta scores:
                     E()=9e-50, 79.2% id in 144 aa, and to Vibrio
                     parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
                     subname: full=mioc protein UniProt:MioC (144 aa) fasta
                     scores: E()=1.1e-46, 75.7% id in 144 aa"
     CDS             complement(846..2207)
                     /product="Putative tRNA modification GTP-ase;"
                     /note="user locus_tag: VANGcI0002c"
                     /note="Similar to Aliivibrio salmonicida (strain LFI1238)
                     (Vibrio salmonicida (strai LFI1238)) trmE subname:
                     full=probable trnA modification gtpase UniProt:B6EP39
                     (EMBL:FM178379) (455 aa) fasta scores: E()=5.8e-145, 88.1%
                     id in 453 aa"
     CDS             complement(2320..3801)
                     /product="probable inner membrane protein oxaA"
                     /note="user locus_tag: VANGcI0003c"
     misc_feature    complement(join(2395..2463,2524..2592,2635..2703,
                     /note="4 probable transmembrane helices predicted for
                     TVA0422 by TMHMM2.0 at aa 293-315, 367-389, 404-426 and
     CDS             complement(3945..4205)
                     /product="putative membrane protein insertion efficiency
                     /note="user locus_tag: VANGcI0004c"
                     /note="Similar to Vibrio sp. AND4 recname: full=putative
                     membrane protein insertion efficiency factor
                     UniProt:Putative (85 aa) blastp scores: E()=1e-47"
     CDS             complement(4172..4528)
                     /product="ribonuclease P protein component (RNase P
                     /note="user locus_tag: VANGcI0005c"
                     /note="Similar to Vibrio cholerae serotype O1 (strain ATCC
                     39541/Ogawa 395/O395) rnpa recname: full=ribonuclease p
                     protein component short=rnasep protein short=rnase p
                     protein ec= altname: full=protein c5
                     UniProt:A5F483 (EMBL:CP000627) (118 aa) fasta scores:
                     E()=4.8e-39, 84.7% id in 118 aa. Different startcodon
                     believed to be right (supported through
     CDS             complement(4541..4678)
                     /product="50s ribosomal protein L34"
                     /note="user locus_tag: VANGcI0006c"
                     /note="Similar to Vibrio sp. AND4 rpmH orfnames=and4_17089
                     UniProt:uniprot_trembl_bacteria (44 aa) fasta scores:
                     E()=4.4e-16, 100.0% id in 43 aa"
     CDS             complement(4875..5624)
                     /product="amino acid ABC transporter, ATP-binding protein"
                     /note="user locus_tag: VANGcI0007c"
                     /note="Similar to Vibrio cholerae serotype O1 (strain ATCC
                     39541/Ogawa 395/O395) subname: full=amino acid abc
                     transporter, ATP-binding protein UniProt:A5F481
                     (EMBL:CP000627) (245 aa) fasta scores: E()=1.1e-79, 87.7%
                     id in 244 aa, and to Vibrio parahaemolyticus serotype
                     O3:K6 (strain RIMD 2210633) subname: full=amino acid abc
                     transporter, atp-binding protein UniProt:Q87TR2
                     (EMBL:BA000031) (245 aa) fasta scores: E()=2.2e-80, 88.2%
                     id in 245 aa. Cfr also V. harveyi, B392; gene patP
                     (Berenstein, D.&al 2002)"
     CDS             complement(5621..6292)
                     /product="putative amino-acid ABC transporter permease
                     protein, PatM"
                     /note="user locus_tag: VANGcI0008c"
                     /note="Similar to Vibrio cholerae serotype O1 (strain ATCC
                     39541/Ogawa 395/O395) subname: full=amino acid abc
                     transproter, permease protein subname: full=amino acid abc
                     transporter, permease protein UniProt:A5F480
                     (EMBL:CP000627) (223 aa) fasta scores: E()=2.9e-74, 90.1%
                     id in 223 aa, and to Vibrio harveyi (Beneckea harveyi)
                     patm recname: full=probable amino-acid abc transporter
                     permease protein patm UniProt:P52625 (EMBL:L47617) (223
                     aa) fasta scores: E()=9.1e-75, 90.6% id in 223 aa"
     misc_feature    complement(join(5675..5743,5786..5854,5981..6049,
                     /note="5 probable transmembrane helices predicted for
                     TVA0425 by TMHMM2.0 at aa 24-46, 59-78, 82-104, 147-169
                     and 184-206"
     CDS             complement(6368..7117)
                     /product="putative amino-acid ABC
                     transporter,substrate-binding protein"
                     /note="user locus_tag: VANGcI0009c"
                     /note="Similar to Vibrio cholerae serotype O1 (strain ATCC
                     39541/Ogawa 395/O395) subname: full=amino acid abc
                     transporter, periplasmic amino acid-binding portion
                     subname: full=amino acid abc transporter, periplasmic
                     amino acid-binding protein UniProt:A5F479 (EMBL:CP000627)
                     (248 aa) fasta scores: E()=8.1e-83, 83.4% id in 247 aa,
                     and to Vibrio harveyi (Beneckea harveyi) path recname:
                     full=putative amino-acid abc transporter-binding protein
                     path flags: precursor UniProt:P52626 (EMBL:L47617) (248
                     aa) fasta scores: E()=7.2e-86, 85.8% id in 247 aa; + also
                     Similar to Escherichia coli Cystine-binding periplasmic
                     protein precursor FliY UniProt:P0AEM9 (266 aa) fasta
                     scores: E()=6.8e-24, 40.969% id in 227 aa, cfr
     regulatory      complement(7138..7140)
                     /note="Promoter (between dnaA-)patH, 309 nt: Threshold for
                     promoters-0.20. Number of predicted promoters=1. Promoter
                     Pos: 287 LDF-4.42; -10 box at pos. 272 cagtaacat, Score
                     51; -35 box at pos. 250 tttatt, Score 34; Oligonucleotides
                     from known TF binding sites, For promoter at 287: [lrp:
                     TATTTATT, at position 248 Score-8; fis: TATTCTAT at
                     position 252 Score-10; fnr: ATAAATAT at position
     regulatory      complement(7147..7155)
                     /note="-10 signal; the seq/forw strand between dnaA and
                     patH (309 nt) contains a promoter in position 287"
     regulatory      7147..7152
                     /note="-35 signal (between patH-)dnaA; 309nt. Contains a
                     promoter in position 64"
     regulatory      7166..7174
                     /note="-10 signal; (between patH-)dnaA; 309nt. Contains a
                     promoter in position 64"
     regulatory      complement(7172..7177)
                     /note="-35 signal; the seq/forw strand between dnaA and
                     patH (309 nt) contains a promotor in position 287"
     regulatory      7181..7183
                     /note="Promoter (between patH-)dnaA; 309nt: Threshold for
                     promoters-0.20. Number of predicted promoters - 1;
                     Promoter Pos: 64 LDF- 5.40; -10 box at pos.49 caatagaat
                     Score 47; -35 box at pos.30 atgtta, Score 15.
                     Oligonucleotides from known TF binding sites, For promoter
                     at 64: [narL: ACTCCTTA at position 7 Score-18; gcvA:
                     TTATATTT at position 12 Score-11; rpoD17: AATAAATA at
                     position 55 Score-11; lexA: ATAAATAA at position 56
     regulatory      complement(7233..7244)
                     /note="GATC sequence, in OriC_EC (occuring 2x in chr1)"
     regulatory      complement(7249..7260)
                     /note="GATC sequence, in OriC_EC (occuring 2x in chr1)"
     regulatory      complement(7284..7295)
                     /note="GATC sequence, in OriC_EC (occuring 4x in chr1)"
     regulatory      7314..7337
                     /note="putative DnaA box2; cfr Berenstein, D.&al; J
                     Bacteriol 2002, 184(9):2533-2538"
     misc_feature    complement(7314..7322)
                     /note="E.coli DnaA-box consensus sequence: 5'-TTATNCACA-3;
                     cfr Rajewska M.&al, FEMS Microbiol Rev 36 (2012) 408-434.
                     Cfr also the Rv-mer, fig2 in Saha et al, 2004"
     regulatory      complement(7323..7334)
                     /note="GATC sequence, in OriC_EC (occuring 2x in chr1)"
     regulatory      complement(7337..7348)
                     /note="GATC sequence, in OriC_EC (occuring 3x in chr1)"
     regulatory      complement(7344..7355)
                     /note="GATC sequence, in OriC_EC (occuring 1x in chr1)"
     regulatory      complement(7358..7369)
                     /note="GATC sequence, in OriC_EC (occuring 2x in chr1)"
     regulatory      complement(7396..7407)
                     /note="GATC sequence, in OriC_EC (occuring 2x in chr1)"
     CDS             7427..8830
                     /product="chromosomal replication initiator protein DnaA"
                     /note="user locus_tag: VANGcI0010"
                     /note="Similar to Vibrio cholerae serotype O1 (strain ATCC
                     39541/Ogawa 395/O395) dnaa recname: full=chromosomal
                     replication initiator protein dnaa UniProt:A5F477
                     (EMBL:CP000627) (472 aa) fasta scores: E()=5.2e-175, 94.4%
                     id in 467 aa. Different startcodon believed to be right
                     (supported through PacBio-sequencing)"
     CDS             8904..10004
                     /product="DNA polymerase III subunit beta-subunit"
                     /note="user locus_tag: VANGcI0011"
                     /note="Similar to Vibrio cholerae serotype O1 (strain ATCC
                     39541/Ogawa 395/O395) dnan subname: full=dna polymerase
                     iii, beta chain ec= UniProt:A5F494 (EMBL:CP000627)
                     (366 aa) fasta scores: E()=1.3e-133, 90.4% id in 366 aa"
     CDS             10014..11093
                     /product="DNA replication and repair protein RecF"
                     /note="user locus_tag: VANGcI0012"
                     /note="Similar to Vibrio cholerae serotype O1 (strain ATCC
                     39541/Ogawa 395/O395) recf recname: full=dna replication
                     and repair protein recf UniProt:A5F493 (EMBL:CP000627)
                     (363 aa) fasta scores: E()=8.5e-128, 84.6% id in 363 aa"
     CDS             11113..13530
                     /product="DNA gyrase subunit B"
                     /note="user locus_tag: VANGcI0013"
                     /note="Similar to Vibrio cholerae serotype O1 (strain ATCC
                     39541/Ogawa 395/O395) gyrb recname: full=dna gyrase
                     subunit b ec= UniProt:A5F492 (EMBL:CP000627) (805
                     aa) fasta scores: E()=0, 90.6% id in 805 aa"
     CDS             13908..14309
                     /product="Putative uncharacterized protein"
                     /note="user locus_tag: VANGcI0014"
                     /note="Suspicious startcodon believed to be right
                     (supported through PacBio-sequencing)"
     CDS             14846..15283
                     /product="small heat shock protein, HSP20 family"
                     /note="user locus_tag: VANGcI0015"
     CDS             complement(15352..16599)
                     /product="Valine-pyruvate aminotransferase"
                     /note="user locus_tag: VANGcI0016c"
                     /note="Similar to Vibrio cholerae serotype O1 (strain ATCC
                     39541/Ogawa 395/O395) avta subname: full=valine-pyruvate
                     aminotransferase ec= UniProt:A5F488
                     (EMBL:CP000627) (418 aa) fasta scores: E()=1.6e-153, 84.6%
                     id in 415 aa"
     CDS             complement(16813..18894)
                     /product="glycine-tRNA synthetase, beta subunit"
                     /note="user locus_tag: VANGcI0017c"
                     /note="Similar to Vibrio cholerae serotype O1 (strain ATCC
                     39541/Ogawa 395/O395) glys recname: full=glycyl-trna
                     synthetase beta subunit ec= altname:
                     full=glycine--trna ligase beta subunit short=glyrs
                     UniProt:A5F487 (EMBL:CP000627) (688 aa) fasta scores:
                     E()=0, 86.3% id in 693 aa"
     CDS             complement(18896..19813)
                     /product="glycine-tRNA synthetase, alpha subunit"
                     /note="user locus_tag: VANGcI0018c"
                     /note="Similar to Aliivibrio salmonicida (strain LFI1238)
                     (Vibrio salmonicida (strai LFI1238)) glyq recname:
                     full=glycyl-trna synthetase alpha subunit ec=
                     altname: full=glycine--trna ligase alpha subunit
                     short=glyrs UniProt:B6EGT2 (EMBL:FM178379) (310 aa) fasta
                     scores: E()=2.1e-127, 94.7% id in 300 aa"
     CDS             20228..20782
                     /product="probable membrane protein"
                     /note="user locus_tag: VANGcI0019"
                     /note="Similar to Aliivibrio salmonicida (strain LFI1238)
                     (Vibrio salmonicida (strai LFI1238)) subname:
                     full=membrane protein flags: precursor UniProt:B6EPX1
                     (EMBL:FM178380) (189 aa) fasta scores: E()=2e-53, 84.4% id
                     in 180 aa. Suspicious startcodon believed to be right
                     (supported through PacBio-sequencing)"
     misc_feature    join(20330..20398,20426..20485,20522..20590,20618..20686,
                     /note="5 probable transmembrane helices predicted for
                     TVA0436 by TMHMM2.0 at aa 35-57, 67-86, 99-121, 131-153
                     and 165-183"
     CDS             20938..21198
                     /product="Putative membrane protein"
                     /note="user locus_tag: VANGcI0020"
     misc_feature    join(20974..21027,21037..21105)
                     /note="2 probable transmembrane helices predicted for
                     TVA0437 by TMHMM2.0 at aa 13-30 and 34-56"
     CDS             complement(21298..21546)
                     /product="Sulfurtransferase tusA homolog"
                     /note="user locus_tag: VANGcI0021c"
                     /note="Similar to Vibrio cholerae serotype O1 (strain ATCC
                     39541/Ogawa 395/O395) tusa recname: full=sulfurtransferase
                     tusa homolog ec=2.8.1.- UniProt:A5F4A1 (EMBL:CP000627) (82
                     aa) fasta scores: E()=2e-27, 80.5% id in 82 aa"
     CDS             22022..22966
                     /product="HTH-type transcriptional regulator, lysR family"
                     /note="user locus_tag: VANGcI0022"
     CDS             complement(23013..23993)
                     /product="putative zinc-binding alcohol dehydrogenase"
                     /note="user locus_tag: VANGcI0023c"
     CDS             complement(24141..25679)
                     /product="Threonine dehydratase"
                     /note="user locus_tag: VANGcI0024c"
                     /note="Similar to Vibrio cholerae serotype O1 (strain ATCC
                     39541/Ogawa 395/O395) ilva subname: full=threonine
                     dehydratase ec= UniProt:A5F498 (EMBL:CP000627)
                     (510 aa) fasta scores: E()=1.4e-184, 88.2% id in 508 aa"
     CDS             complement(25683..27524)
                     /product="Dihydroxy-acid dehydratase"
                     /note="user locus_tag: VANGcI0025c"
     CDS             complement(27541..28479)
                     /product="Branched-chain-amino-acid transaminase"
                     /note="user locus_tag: VANGcI0026c"
                     /note="Similar to Vibrio cholerae serotype O1 (strain ATCC
                     39541/Ogawa 395/O395) ilve subname: full=branched-chain
                     amino acid amiotransferase ec= UniProt:A5F496
                     (EMBL:CP000627) (319 aa) fasta scores: E()=6.6e-119, 91.0%
                     id in 312 aa"
     CDS             complement(28492..28776)
                     /product="Acetolactate synthase II, small subunit"
                     /note="user locus_tag: VANGcI0027c"
                     /note="Similar to Vibrio cholerae serotype O1 (strain ATCC
                     39541/Ogawa 395/O395) ilvm subname: full=acetolactate
                     synthase ii, small subunit ec= UniProt:A5F495
                     (EMBL:CP000627) (94 aa) fasta scores: E()=4e-32, 88.3% id
                     in 94 aa"
     CDS             complement(28776..30422)
                     /product="Acetolactate synthase"
                     /note="user locus_tag: VANGcI0028c"
     CDS             30900..31808
                     /product="competence protein, ComM-related
                     (pseudogene,N-term fragment)"
                     /note="user locus_tag: VANGcI0029"
                     /note="Similar to Vibrio parahaemolyticus subname:
                     full=comm-related protein UniProt:Q87KC0 (EMBL:BA000031)
                     (507 aa) fasta scores: E()=1.3e-98, 84.8% id in 303 aa,
                     and to Haemophilus influenzae comm
                     orderedlocusnames=hi_1117 UniProt:Competence (509 aa)
                     fasta scores: E()=2e-70, 66.8% id in 307 aa. The CDS seem
                     to be truncated in the C-terminus."
     CDS             31960..34305
                     /product="putative uncharacterized protein"
                     /note="user locus_tag: VANGcI0030"
                     /note="Contains 3 classical DnaA boxes: TTwTnCACA.
                     Suspicious startcodon believed to be right (supported
                     through PacBio-sequencing)"
     CDS             34299..36713
                     /product="putative site-specific recombinase, phage
                     integrase family domain protein"
                     /note="user locus_tag: VANGcI0031"
                     /note="PF00589: Members of this family cleave DNA
                     substrates by a series of staggered cuts, during which the
                     protein becomes covalently linked to the DNA through a
                     catalytic tyrosine residue at the carboxy end of the
     CDS             36725..37255
                     /product="putative uncharacterized protein"
                     /note="user locus_tag: VANGcI0032"
                     /note="Insignificant Pfam-A protein sequence matches"
     CDS             37255..38619
                     /product="putative phage recombinase/integrase"
                     /note="user locus_tag: VANGcI0033"
     CDS             complement(38842..40017)
                     /product="putative uncharacterized protein"
                     /note="user locus_tag: VANGcI0034c"
     CDS             40199..41422
                     /product="putative uncharacterized protein"
                     /note="user locus_tag: VANGcI0035"
     CDS             42429..43634
                     /product="putative uncharacterized protein"
                     /note="user locus_tag: VANGcI0036"
     CDS             43627..45417
                     /product="putative uncharacterized protein"
                     /note="user locus_tag: VANGcI0037"
     CDS             45422..45892
                     /product="putative uncharacterized protein"
                     /note="user locus_tag: VANGcI0038"
     CDS             45882..46397
                     /product="putative uncharacterized (membrane) protein"
                     /note="user locus_tag: VANGcI0039"
                     /note="The CDS contains 3 predicted transmembrane helixes
     misc_feature    join(45942..46010,46053..46121,46158..46226)
                     /note="3 probable transmembrane helices predicted for
                     TVA3553 by TMHMM2.0 at aa 21-43, 58-80 and 93-115"
     repeat_region   46509..48889
                     /note="NB10_ISVa5 (2.381 bp; complete); three-orf
     CDS             46589..46906
                     /product="transposase ISVa5 (orfA; IS66-family)"
                     /note="user locus_tag: VANGcI0040"
                     /note="transposase, ISVa5 (IS66-family; 105aa)"
     CDS             46903..47256
                     /product="transposase ISVa5 (orfB; IS66-family)"
                     /note="user locus_tag: VANGcI0041"
                     /note="transposase, ISVa5 (IS66-family; 117aa)"
     CDS             47316..48857
                     /product="transposase ISVa5 (orfC; IS66-family)"
                     /note="user locus_tag: VANGcI0042"
                     /note="Transposase ISVa5 (IS66-family; 513aa)"
     CDS             complement(49020..51500)
                     /product="putative uncharacterized protein [DNA/RNA
                     helicase (c2-type; DEAD/DEAH box type)]"
                     /note="user locus_tag: VANGcI0043c"
                     /note="Similar to Salmonella enterica subsp. enterica
                     serovar 4,[5],12:i:- str CVM23701 subname: full=helicase
                     c2 UniProt:Helicase (827 aa) fasta scores: E()=1.9e-172,
                     51.4% id in 821 aa, and to Lactococcus lactis orf00041
                     subname: full=putative uncharacterized protein orf00041
                     UniProt:Putative (844 aa) fasta scores: E()=2.2e-62, 31.1%
                     id in 856 aa, and to Salmonella enterica subsp. enterica
                     serovar 4,[5],12:i:- str CVM23701 subname: full=helicase
                     c2 UniProt:Helicase (827 aa) blastp scores: E()=0.0.
                     Merger of former CDSs: 0398, 3184 and 3633; contains a
                     putative Mg++ binding site, and also a CRISPR/Cas system
                     associated DinG family helicase, Csf4_U (cfr similarity
     CDS             51887..52501
                     /product="Putative competence protein
                     (comM,C-term-fragment; pseudogene)"
                     /note="user locus_tag: VANGcI0044"
                     /note="The CDS, ComM, seem to be truncated at the
     CDS             complement(52507..53466)
                     /product="Putative uncharacterized protein"
                     /note="user locus_tag: VANGcI0045c"
     CDS             complement(53701..54300)
                     /product="Thiol/disulfide interchange protein, DsbA?"
                     /note="user locus_tag: VANGcI0046c"
                     /note="Similar to Vibrio anguillarum (Listonella
                     anguillarum) tdi subname: full=tdi UniProt:B5LBG5
                     (EMBL:EU650390) (203 aa) fasta scores: E()=6.6e-79, 100.0%
                     id in 199 aa"
     CDS             complement(54331..55317)
                     /product="Protein RdoA"
                     /function="Probably involved in the extracytoplasmic
                     stress response (by similarity)."
                     /note="user locus_tag: VANGcI0047c"
                     /note="Similar to Escherichia coli (strain K12) rdoa
                     recname: full=protein rdoa UniProt:P0C0K3 (EMBL:AP009048)
                     (328 aa) fasta scores: E()=7.5e-85, 56.4% id in 328 aa,
                     and to Vibrio anguillarum (Listonella anguillarum) hsk
                     subname: full=hsk UniProt:B5LBG6 (EMBL:EU650390) (328 aa)
                     fasta scores: E()=3e-146, 99.4% id in 328 aa, and to
                     Escherichia coli O6:H1 (strain CFT073/ATCC 700928/UPEC)
                     rdoa recname: full=protein rdoa UniProt:P0C0K4 (328 aa)
                     fasta scores: E()=7.5e-85, 56.4% id in 328 aa"
     CDS             complement(55364..56782)
                     /product="Putative ferredoxin"
                     /note="user locus_tag: VANGcI0048c"
                     /note="Similar to Aliivibrio salmonicida (strain LFI1238)
                     (Vibrio salmonicida (strai LFI1238)) subname:
                     full=putative ferredoxin UniProt:B6ENZ6 (EMBL:FM178379)
                     (472 aa) fasta scores: E()=6.3e-161, 74.4% id in 472 aa"
     misc_feature    complement(join(55700..55759,56123..56182,56225..56284,
                     /note="5 probable transmembrane helices predicted for
                     TVA0393 by TMHMM2.0 at aa 49-66, 93-115, 167-186, 201-220
                     and 342-361"
     CDS             complement(57048..57314)
                     /product="Putative uncharacterized protein"
                     /note="user locus_tag: VANGcI0049c"
     CDS             58023..58682
                     /product="Putative hemolysin III"
                     /note="user locus_tag: VANGcI0050"
                     /note="Similar to Aliivibrio salmonicida (strain LFI1238)
                     (Vibrio salmonicida (strai LFI1238)) hlyiii subname:
                     full=hemolysin iii flags: precursor UniProt:B6ENZ9
                     (EMBL:FM178379) (215 aa) fasta scores: E()=3.8e-52, 67.9%
                     id in 209 aa"
     misc_feature    join(58077..58145,58173..58241,58278..58337,58350..58418,
                     /note="7 probable transmembrane helices predicted for
                     TVA0391 by TMHMM2.0 at aa 19-41, 51-73, 86-105,
                     110-132,139-158, 163-185 and 192-214"
     CDS             complement(58679..59188)
                     /product="Putative uncharacterized protein"
                     /note="user locus_tag: VANGcI0051c"
     CDS             complement(59226..60608)
                     /product="Potassium uptake protein trkH"
                     /note="user locus_tag: VANGcI0052c"
                     /note="Similar to Vibrio cholerae serotype O1 (strain ATCC
                     39541/Ogawa 395/O395) trkh-1 subname: full=potassium
                     uptake protein trkh UniProt:A5F4B7 (EMBL:CP000627) (481
                     aa) fasta scores: E()=3.4e-153, 84.7% id in 459 aa"
     misc_feature    complement(join(59244..59312,59442..59510,59643..59711,
                     /note="9 probable transmembrane helices predicted for
                     TVA0389 by TMHMM2.0 at aa 15-37, 49-71, 111-133,
                     162-184,212-234, 254-276, 300-322, 367-389 and 433-455"
     CDS             complement(60684..62060)
                     /product="Trk system potassium uptake protein trkA"
                     /note="user locus_tag: VANGcI0053c"
                     /note="Similar to Aliivibrio salmonicida (strain LFI1238)
                     (Vibrio salmonicida (strai LFI1238)) trka subname:
                     full=trk system potassium uptake protein trka
                     UniProt:B6EP18 (EMBL:FM178379) (458 aa) fasta scores:
                     E()=1.2e-157, 90.0% id in 458 aa"
     CDS             complement(62135..63415)
                     /product="ribosomal RNA small subunit methyltransferase B"
                     /note="user locus_tag: VANGcI0054c"
                     /note="vsal: Possible alternative translational start site
                     after codon 18"
     CDS             complement(63475..64422)
                     /product="Methionyl-tRNA formyltransferase. Suspicious
                     startcodon believed to be right (supported through
                     /note="user locus_tag: VANGcI0055c"
                     /note="Similar to Vibrio cholerae serotype O1 (strain ATCC
                     39541/Ogawa 395/O395) fmt recname: full=methionyl-trna
                     formyltransferase ec= UniProt:A5F4B4
                     (EMBL:CP000627) (315 aa) fasta scores: E()=1.7e-104, 81.6%
                     id in 315 aa"
     CDS             complement(64439..64948)
                     /product="Peptide deformylase"
                     /note="user locus_tag: VANGcI0056c"
                     /note="Similar to Vibrio cholerae serotype O1 (strain ATCC
                     39541/Ogawa 395/O395) def-1 recname: full=peptide
                     deformylase UniProt:A5F4B3 (EMBL:CP000627) (169 aa) fasta
                     scores: E()=2.3e-58, 89.3% id in 168 aa"
     CDS             65089..66219
                     /product="Putative cell wall degradation enzyme"
                     /note="user locus_tag: VANGcI0057"
     misc_feature    65107..65160
                     /note="1 probable transmembrane helix predicted for
                     TVA0384 by TMHMM2.0 at aa 7-24"
     CDS             66219..67328
                     /product="smf protein"
                     /function="DprA is a widely conserved bacterial protein
                     and has been shown to confer an important function during
                     transformation in competent cells, possibly through
                     protection of incoming DNA. B. subtilis DprA (called Smf)
                     and has been shown to play an important role during
                     transformation with chromosomal DNA, but its mode of
                     action is unknown. ... Smf is much more important for
                     plasmid transformation than RecA, but RecA influences the
                     dynamic localization pattern of Smf. ... data show that
                     DprA/Smf acts downstream of the DNA uptake machinery, and
                     support the idea that Smf protects incoming ssDNA,
                     possibly in conjunction with RecA."
                     /note="user locus_tag: VANGcI0058"
                     /note="Similar to Aliivibrio salmonicida (strain LFI1238)
                     (Vibrio salmonicida (strai LFI1238)) smf subname: full=smf
                     protein UniProt:B6EP23 (EMBL:FM178379) (369 aa) fasta
                     scores: E()=1.4e-78, 56.7% id in 365 aa"
     CDS             67334..67807
                     /product="Protein smg homolog"
                     /product="conserved hypothetical protein"
                     /note="user locus_tag: VANGcI0059"
                     /note="Similar to Vibrio cholerae serotype O1 (strain ATCC
                     39541/Ogawa 395/O395) smg recname: full=protein smg
                     homolog UniProt:A5F4C9 (EMBL:CP000627) (158 aa) fasta
                     scores: E()=1.4e-51, 86.0% id in 157 aa"
     CDS             67835..68407
                     /product="DNA topoisomerase"
                     /note="user locus_tag: VANGcI0060"
                     /note="Similar to Aliivibrio salmonicida (strain LFI1238)
                     (Vibrio salmonicida (strai LFI1238)) yrdd subname:
                     full=dna topoisomerase ec= UniProt:B6EP25
                     (EMBL:FM178379) (189 aa) fasta scores: E()=6.2e-49, 58.1%
                     id in 186 aa"
     CDS             complement(68480..69619)
                     /product="Phosphoribosylaminoimidazole carboxylase, ATPase
                     /note="user locus_tag: VANGcI0061c"
                     /note="Similar to Vibrio cholerae serotype O1 (strain ATCC
                     39541/Ogawa 395/O395) purk subname:
                     full=phosphoribosylaminoimidazole carboxylase, atpase
                     subunit ec= UniProt:A5F4C7 (EMBL:CP000627) (377
                     aa) fasta scores: E()=1.1e-114, 73.5% id in 377 aa"
     CDS             complement(69624..70109)
                     carboxylase,catalytic subunit"
                     /note="user locus_tag: VANGcI0062c"
                     /note="Similar to Vibrio cholerae serotype O1 (strain ATCC
                     39541/Ogawa 395/O395) pure subname:
                     full=phosphoribosylaminoimidazole carboxylase, catalytic
                     subunit ec= UniProt:A5F4C6 (EMBL:CP000627) (161
                     aa) fasta scores: E()=1.4e-46, 85.1% id in 161 aa"
     CDS             70310..70867
                     /product="Putative ribosome maturation factor rimN"
                     /note="user locus_tag: VANGcI0063"
                     /note="Similar to Vibrio cholerae serotype O1 (strain ATCC
                     39541/Ogawa 395/O395) rimn recname: full=putative ribosome
                     maturation factor rimn UniProt:A5F4C5 (EMBL:CP000627) (188
                     aa) fasta scores: E()=7.7e-51, 65.9% id in 185 aa.
                     Suspicious startcodon believed to be right (supported
                     through PacBio-sequencing)."
     CDS             70888..71802
                     /product="Coproporphyrinogen-III oxidase, aerobic"
                     /note="user locus_tag: VANGcI0064"
                     /note="Similar to Vibrio cholerae serotype O1 (strain ATCC
                     39541/Ogawa 395/O395) hemf recname:
                     full=coproporphyrinogen-iii oxidase, aerobic
                     short=coproporphyrinogenase short=coprogen oxidase
                     ec= UniProt:A5F4C4 (EMBL:CP000627) (305 aa) fasta
                     scores: E()=3e-115, 80.7% id in 301 aa"
     CDS             71867..72697
                     /product="Shikimate dehydrogenase"
                     /note="user locus_tag: VANGcI0065"
                     /note="Similar to Vibrio cholerae serotype O1 (strain ATCC
                     39541/Ogawa 395/O395) aroe recname: full=shikimate
                     dehydrogenase ec= UniProt:A5F4C3 (EMBL:CP000627)
                     (278 aa) fasta scores: E()=4.6e-88, 77.9% id in 276 aa"
     CDS             72700..72966
                     /product="Putative uncharacterized protein"
                     /note="user locus_tag: VANGcI0066"
                     /note="Similar to Vibrio cholerae serotype O1 (strain ATCC
                     39541/Ogawa 395/O395) subname: full=putative
                     uncharacterized protein UniProt:A5F4C2 (EMBL:CP000627) (91
                     aa) fasta scores: E()=4.8e-17, 57.0% id in 86 aa"
     CDS             complement(72967..73515)
                     /product="Putative transferase (carbonic anhydrase, family
                     /note="user locus_tag: VANGcI0067c"
                     /note="Similar to Aliivibrio salmonicida (strain LFI1238)
                     (Vibrio salmonicida (strai LFI1238)) subname:
                     full=putative transferase UniProt:B6EP31 (EMBL:FM178379)
                     (181 aa) fasta scores: E()=1.6e-50, 70.7% id in 174 aa"
     rRNA            74067..75610
                     /product="16S rRNA"
                     /note="16S rRNA subunit (checked and believed to be
                     right,based on 454- and PacBio-sequencing)"
     tRNA            75699..75771
                     /note="tRNA Glu anticodon TTC, Cove score 49,02"
     rRNA            76082..78972
                     /product="23S rRNA"
                     /note="23S rRNA subunit"
     rRNA            79058..79177
                     /product="5S rRNA"
                     /note="5S ribosomal RNA"
     tRNA            79272..79359
                     /note="tRNA Ser anticodon TGA, Cove score 70,97."
     CDS             complement(80004..81185)
                     /product="HemY protein"
                     /note="user locus_tag: VANGcI0068c"
                     /note="Similar to Vibrio cholerae serotype O1 (strain ATCC
                     39541/Ogawa 395/O395) hemy subname: full=hemy protein
                     UniProt:A5F4J4 (EMBL:CP000627) (398 aa) fasta scores:
                     E()=1.7e-106, 69.8% id in 391 aa"
     misc_feature    complement(join(81012..81080,81117..81176))
                     /note="2 probable transmembrane helices predicted for
                     TVA0344 by TMHMM2.0 at aa 4-23 and 36-58"
     CDS             complement(81185..82366)
                     /product="Putative uroporphyrin-III c-methyltransferase
                     /note="user locus_tag: VANGcI0069c"
     misc_feature    complement(82136..82195)
                     /note="1 probable transmembrane helix predicted for
                     TVA0343 by TMHMM2.0 at aa 58-77"
     CDS             complement(82350..83111)
                     /product="Uroporphyrinogen-III synthase"
                     /note="user locus_tag: VANGcI0070c"
     CDS             complement(83115..84053)
                     /product="Porphobilinogen deaminase"
                     /note="user locus_tag: VANGcI0071c"
                     /note="Similar to Aliivibrio salmonicida (strain LFI1238)
                     (Vibrio salmonicida (strai LFI1238)) hemc recname:
                     full=porphobilinogen deaminase short=pbg ec=
                     altname: full=hydroxymethylbilane synthase short=hmbs
                     altname: full=pre-uroporphyrinogen synthase UniProt:B6EPK1
                     (EMBL:FM178379) (311 aa) fasta scores: E()=1.2e-103, 81.9%
                     id in 310 aa"
     CDS             84404..86932
                     /product="Adenylate cyclase"
                     /note="user locus_tag: VANGcI0072"
                     /note="Similar to Vibrio cholerae serotype O1 (strain ATCC
                     39541/Ogawa 395/O395) cyaa subname: full=adenylate cyclase
                     ec= UniProt:A5F4J0 (EMBL:CP000627) (843 aa) fasta
                     scores: E()=0, 84.9% id in 843 aa. Suspicious startcodon
                     believed to be right (supported through
     CDS             complement(86977..87291)
                     /product="Protein cyaY"
                     /note="user locus_tag: VANGcI0073c"
                     /note="Similar to Vibrio cholerae serotype O1 (strain ATCC
                     39541/Ogawa 395/O395) cyay recname: full=protein cyay
                     UniProt:A5F4I9 (EMBL:CP000627) (104 aa) fasta scores:
                     E()=1.4e-35, 81.7% id in 104 aa"
     CDS             87516..88769
                     /product="Diaminopimelate decarboxylase"
                     /note="user locus_tag: VANGcI0074"
                     /note="Similar to Vibrio cholerae serotype O1 (strain ATCC
                     39541/Ogawa 395/O395) lysa recname: full=diaminopimelate
                     decarboxylase ec= UniProt:A5F4I7 (EMBL:CP000627)
                     (417 aa) fasta scores: E()=2.3e-151, 87.3% id in 417 aa.
                     Suspicious startcodon believed to be right (supported
                     through PacBio-sequencing); Frequent codons are
                     ATG/Met,GTG/Val, TTG/Leu."
     CDS             88781..89611
                     /product="Diaminopimelate epimerase"
                     /note="user locus_tag: VANGcI0075"
                     /note="Similar to Vibrio cholerae serotype O1 (strain ATCC
                     39541/Ogawa 395/O395) dapf recname: full=diaminopimelate
                     epimerase short=dap epimerase ec= UniProt:A5F4I6
                     (EMBL:CP000627) (276 aa) fasta scores: E()=2.4e-109, 89.5%
                     id in 276 aa"
     CDS             89636..90340
                     /product="Putative uncharacterized protein"
                     /note="user locus_tag: VANGcI0076"
                     /note="Suspicious startcodon believed to be right
                     (supported through PacBio-sequencing); Frequent codons are
                     ATG/Met, GTG/Val, TTG/Leu."
     CDS             90312..91244
                     /product="Tyrosine recombinase xerC"
                     /note="user locus_tag: VANGcI0077"
                     /note="Similar to Vibrio cholerae serotype O1 (strain ATCC
                     39541/Ogawa 395/O395) xerc recname: full=tyrosine
                     recombinase xerc UniProt:A5F4I4 (EMBL:CP000627) (311 aa)
                     fasta scores: E()=3.1e-96, 81.6% id in 282 aa"
     CDS             91248..91961
                     /product="Putative uncharacterized protein"
                     /note="user locus_tag: VANGcI0078"
     CDS             complement(91947..92552)
                     /product="Putative uncharacterized protein"
                     /note="user locus_tag: VANGcI0079c"
                     /note="Suspicious startcodon believed to be right
                     (supported through PacBio-sequencing); Frequent codons are
                     ATG/Met, GTG/Val, TTG/Leu."
     CDS             complement(92553..93581)
                     /product="putative uncharacterized (lipo)protein"
                     /note="user locus_tag: VANGcI0080c"
     CDS             complement(93771..94598)
                     /product="Putative uncharacterized protein"
                     /note="user locus_tag: VANGcI0081c"
     CDS             complement(94737..95747)
                     /product="Lysophospholipase L2"
                     /note="user locus_tag: VANGcI0082c"
                     /note="Similar to Vibrio cholerae serotype O1 (strain ATCC
                     39541/Ogawa 395/O395) lypa subname: full=lysophospholipase
                     l2 UniProt:A5F4J9 (EMBL:CP000627) (338 aa) fasta scores:
                     E()=5.4e-86, 60.5% id in 319 aa"
     CDS             95822..96439
                     /product="Putative LysE type translocator"
                     /note="user locus_tag: VANGcI0083"
     misc_feature    join(95834..95902,95939..96007,96017..96085,96164..96232,
                     /note="6 probable transmembrane helices predicted for
                     TVA0329 by TMHMM2.0 at aa 5-27, 40-62, 66-88,
                     115-137,147-169 and 185-203"
     CDS             96475..97701
                     /product="Putative uncharacterized protein"
                     /product="Putative signaling protein"
                     /note="user locus_tag: VANGcI0084"
                     /note="Signal transduction c-di-GMP
                     phosphodiesterase,EAL/HD-GYP domain-containing"
     CDS             complement(97765..98235)
                     /product="DPS family protein"
                     /note="user locus_tag: VANGcI0085c"
                     /note="Similar to Vibrio cholerae serotype O1 (strain ATCC
                     39541/Ogawa 395/O395) subname: full=dps family protein
                     UniProt:A5F4J5 (EMBL:CP000627) (156 aa) fasta scores:
                     E()=2.8e-51, 78.2% id in 156 aa"
     CDS             98456..99469
                     /product="Probable membrane protein"
                     /note="user locus_tag: VANGcI0086"
     misc_feature    join(98468..98536,98579..98647,98708..98776,98819..98887,
                     /note="10 probable transmembrane helices predicted for
                     TVA0326 by TMHMM2.0 at aa 5-27, 42-64, 85-107,
                     122-144,156-178, 182-196, 203-225, 240-262, 275-294 and
     CDS             complement(99466..99795)
                     /product="Putative uncharacterized protein"
                     /note="user locus_tag: VANGcI0087c"
                     /note="Similar to Vibrio cholerae serotype O1 (strain ATCC
                     39541/Ogawa 395/O395) subname: full=putative
                     uncharacterized protein UniProt:A5F4L5 (EMBL:CP000627)
                     (109 aa) fasta scores: E()=2.3e-36, 75.2% id in 109 aa"
     misc_feature    complement(99724..99783)
                     /note="1 probable transmembrane helix predicted for
                     TVA0325 by TMHMM2.0 at aa 5-24"
     CDS             100016..100390
                     /product="Putative uncharacterized protein"
                     /note="user locus_tag: VANGcI0088"
                     /note="Similar to Vibrio cholerae serotype O1 (strain ATCC
                     39541/Ogawa 395/O395) subname: full=putative
                     uncharacterized protein UniProt:A5F4L4 (EMBL:CP000627)
                     (122 aa) fasta scores: E()=9.6e-40, 77.5% id in 120 aa"
     misc_feature    100283..100351
                     /note="1 probable transmembrane helix predicted for
                     TVA0324 by TMHMM2.0 at aa 90-112"
     CDS             101306..101929
                     /product="Putative uncharacterized membrane protein"
                     /note="user locus_tag: VANGcI0089"
     misc_feature    join(101381..101434,101453..101521,101603..101671,
                     /note="6 probable transmembrane helices predicted for
                     TVA0323 by TMHMM2.0 at aa 26-43, 50-72, 100-122,
                     127-144,154-176 and 183-205"
     CDS             102030..102446
                     /product="Putative uncharacterized protein"
                     /note="user locus_tag: VANGcI0090"
     misc_feature    join(102039..102107,102141..102200,102342..102410)
                     /note="3 probable transmembrane helices predicted for
                     TVA0322 by TMHMM2.0 at aa 4-26, 38-57 and 105-127"
     mRNA            complement(102851..103015)
                     /product="putative RNA-binding protein (fragment/signal
     repeat_region   complement(103025..105405)
                     /note="NB10_ISVa5 (2.381 bp; complete); three-orf
     CDS             complement(103057..104598)
                     /product="transposase, ISVa5 (orfC; IS66-family)"
                     /note="user locus_tag: VANGcI0091c"
                     /note="Transposase, ISVa5 (IS66-family; 513aa)"
     CDS             complement(104658..105011)
                     /product="transposase, ISVa5 (orfB; IS66-family)"
                     /note="user locus_tag: VANGcI0092c"
                     /note="transposase, ISVa5 (IS66-family; 117aa)"
     CDS             complement(105008..105325)
                     /product="transposase, ISVa5 (orfA; IS66-family)"
                     /note="user locus_tag: VANGcI0093c"
                     /note="transposase, ISVa5 (IS66-family; 105aa)"
     CDS             complement(105406..106519)
                     /product="phage integrase family protein"
                     /note="user locus_tag: VANGcI0094c"
                     /note="the CDS seem to be truncated at the
                     3'end/C-terminus (by an ISVa5-element)"
     CDS             complement(106516..106821)
                     /product="phage integrase family protein"
                     /note="user locus_tag: VANGcI0095c"
     repeat_region   106856..107909
                     /note="NB10_ISVa2 (complete: 1.054 bp); Accession
     CDS             106935..107855
                     /product="Transposase, ISVa2 (IS5 family)"
                     /note="user locus_tag: VANGcI0096"
     CDS             complement(107852..109015)
                     /product="putative uncharacterized protein"
                     /note="user locus_tag: VANGcI0097c"
     CDS             109257..109511
                     /product="UPF0056 inner membrane protein YhgN"
                     /note="user locus_tag: VANGcI0098"
                     /note="Similar to Escherichia coli (strain K12) yhgn
                     recname: full=upf0056 inner membrane protein yhgn
                     UniProt:P67143 (EMBL:U00096) (197 aa) fasta scores:
                     E()=2.3e-15, 51.2% id in 82 aa"
     misc_feature    join(109341..109409,109428..109481)
                     /note="2 probable transmembrane helices predicted for
                     TVA3689 by TMHMM2.0 at aa 29-51 and 58-75"
     CDS             complement(109587..109853)
                     /product="putative uncharacterized (membrane) protein"
                     /note="user locus_tag: VANGcI0099c"
     misc_feature    complement(join(109683..109751,109779..109847))
                     /note="2 probable transmembrane helices predicted for
                     TVA3688 by TMHMM2.0 at aa 3-25 and 35-57"
     CDS             complement(109850..110449)
                     /product="Ribosomal RNA small subunit methyltransferase D"
                     /note="user locus_tag: VANGcI0100c"
                     /note="Similar to Escherichia coli (strain K12) rsmd
                     recname: full=ribosomal rna small subunit
                     methyltransferase d ec= altname: full=rrna
                     (guanine-n(2)-)-methyltransferase altname: full=16s rrna
                     m2g966 methyltransferase UniProt:P0ADX9 (EMBL:U00096) (198
                     aa) fasta scores: E()=1e-46, 61.7% id in 188 aa"
     CDS             110656..111828
                     /product="Cell division protein FtsY (Signal recognition
                     particle-docking protein FtsY)"
                     /note="user locus_tag: VANGcI0101"
     CDS             111891..112565
                     /product="Cell division ATP-binding protein ftsE"
                     /note="user locus_tag: VANGcI0102"
                     /note="Suspicious startcodon believed to be right
                     (supported through PacBio-sequencing); Frequent VA-codons
                     are ATG/Met, GTG/Val, TTG/Leu."
     CDS             112555..113523
                     /product="cell division protein FtsX"
                     /note="user locus_tag: VANGcI0103"
     misc_feature    join(112684..112752,113119..113187,113284..113352,
                     /note="4 probable transmembrane helices predicted for
                     TVA3684 by TMHMM2.0 at aa 44-66, 189-211, 244-266 and
     CDS             113699..114556
                     /product="RNA polymerase sigma-32 factor"
                     /note="user locus_tag: VANGcI0104"
                     /note="Similar to Escherichia coli (strain K12) rpoh
                     recname: full=rna polymerase sigma-32 factor altname:
                     full=heat shock regulatory protein f33.4 UniProt:P0AGB3
                     (EMBL:U00096) (284 aa) fasta scores: E()=9.6e-80, 72.8% id
                     in 283 aa"
     CDS             114997..115272
                     /product="thiosulfate sulfurtransferase"
                     /note="user locus_tag: VANGcI0105"
     CDS             115281..116114
                     /product="rhomboid protease GlpG (intramembrane serine
                     /note="user locus_tag: VANGcI0106"
                     /note="Similar to Escherichia coli (strain K12) glpg
                     recname: full=rhomboid protease glpg ec=
                     altname: full=intramembrane serine protease UniProt:P09391
                     (EMBL:U00096) (276 aa) fasta scores: E()=4.7e-43, 44.8% id
                     in 279 aa"
     misc_feature    join(115566..115634,115692..115760,115797..115865,
                     /note="5 probable transmembrane helices predicted for
                     TVA3681 by TMHMM2.0 at aa 96-118, 138-160, 173-195,
                     200-219 and 232-251"
     CDS             complement(116147..116554)
                     /product="putative flagellar basal body-associated protein
                     /note="user locus_tag: VANGcI0107c"
     CDS             116803..117345
                     /product="chorismate-pyruvate lyase"
                     /note="user locus_tag: VANGcI0108"
     CDS             117342..118196
                     /product="4-hydroxybenzoate octaprenyltransferase"
                     /note="user locus_tag: VANGcI0109"
                     /note="Similar to Escherichia coli (strain K12) ubia
                     recname: full=4-hydroxybenzoate octaprenyltransferase
                     ec=2.5.1.- altname: full=4-hb polyprenyltransferase
                     UniProt:P0AGK1 (EMBL:U00096) (290 aa) fasta scores:
                     E()=3.8e-74, 64.1% id in 284 aa"
     misc_feature    join(117399..117458,117471..117539,117600..117668,
                     /note="9 probable transmembrane helices predicted for
                     TVA3678 by TMHMM2.0 at aa 20-39, 44-66, 87-109,
                     113-130,137-156, 161-179, 209-226, 231-248 and 261-283"
     CDS             complement(118257..120680)
                     /product="glycerol-3-phosphate acyltransferase"
                     /note="user locus_tag: VANGcI0110c"
                     /note="Similar to Escherichia coli (strain K12) plsb
                     recname: full=glycerol-3-phosphate acyltransferase
                     short=gpat ec= UniProt:P0A7A7 (EMBL:U00096) (807
                     aa) fasta scores: E()=8.5e-194, 57.4% id in 807 aa"
     CDS             121000..121623
                     /product="LexA repressor"
                     /note="user locus_tag: VANGcI0111"
     CDS             121724..122536
                     /product="putative uncharacterized protein"
                     /note="user locus_tag: VANGcI0112"
     CDS             122671..123942
                     /product="DNA-damage-inducible protein F"
                     /note="user locus_tag: VANGcI0113"
                     /note="Similar to Escherichia coli (strain K12) dinf
                     recname: full=dna-damage-inducible protein f
                     UniProt:P28303 (EMBL:U00096) (459 aa) fasta scores:
                     E()=7.4e-68, 47.2% id in 422 aa. The CDS contains 12
                     predicted trenamembrane helixes (TMHMM2.0.model). Multi
                     antimicrobial extrusion protein (IPR002528): Characterised
                     members of the Multi Antimicrobial Extrusion (MATE) family
                     function as drug/sodium antiporters. These proteins
                     mediate resistance to a wide range of cationic dyes,
                     fluroquinolones,aminoglycosides and other structurally
                     diverse antibodies and drugs."
     misc_feature    join(122743..122811,122872..122940,123010..123078,
                     /note="11 probable transmembrane helices predicted for
                     TVA3674 by TMHMM2.0 at aa 25-47, 68-90, 114-136,
                     143-165,175-197, 225-247, 252-274, 295-317, 337-359,
                     371-388 and 392-414"
     CDS             complement(124046..125446)
                     /product="soluble pyridine nucleotide transhydrogenase"
                     /function="Conversion of NADPH, generated by peripheral
                     catabolic pathways, to NADH, which can enter the
                     respiratory chain for energy generation"
                     /note="user locus_tag: VANGcI0114c"
                     /note="Similar to Escherichia coli (strain K12) stha
                     recname: full=soluble pyridine nucleotide transhydrogenase
                     short=sth ec= altname: full=nad(p)(+)
                     transhydrogenase [b-specific] UniProt:P27306 (EMBL:U00096)
                     (466 aa) fasta scores: E()=5.5e-145, 74.2% id in 466 aa"
     CDS             125742..126374
                     /product="HTH-type transcriptional regulator, TetR-family"
                     /note="user locus_tag: VANGcI0115"
                     /note="Similar to Escherichia coli Putative HTH-type
                     transcriptional regulator YijC UniProt:P0ACU5 (215 aa)
                     fasta scores: E()=5.3e-49, 70.792% id in 202 aa. Possible
                     alternative translational start site after codon 7"
     CDS             126374..126751
                     /product="Putative inner membrane protein"
                     /note="user locus_tag: VANGcI0116"
     misc_feature    join(126422..126481,126491..126544,126578..126637,
                     /note="4 probable transmembrane helices predicted for
                     TVA3671 by TMHMM2.0 at aa 17-36, 40-57, 69-88 and 98-120"
     CDS             complement(126911..130012)
                     /note="user locus_tag: VANGcI0117c"
                     /note="Ref ogs P00722: BGAL_ECOLI. Belongs to the glycosyl
                     hydrolase 2 family."
     CDS             complement(130697..131806)
                     /product="tRNA (uracil-5)-methyltransferase"
                     /note="user locus_tag: VANGcI0118c"
     CDS             132135..133568
                     /product="Putative phage integrase family protein"
                     /note="user locus_tag: VANGcI0119"
     CDS             133573..136032
                     /product="putative uncharacterized protein"
                     /note="user locus_tag: VANGcI0120"
     CDS             136044..138233
                     /product="Putative phage integrase family protein"
                     /note="user locus_tag: VANGcI0121"
     CDS             138237..138773
                     /product="putative uncharacterized protein"
                     /note="user locus_tag: VANGcI0122"
     CDS             138956..139537
                     /product="Putative resolvase (DNA invertase/recombinase
                     /note="user locus_tag: VANGcI0123"
     CDS             complement(139621..140022)
                     /product="putative uncharacterized protein"
                     /note="user locus_tag: VANGcI0124c"
     CDS             complement(140060..140473)
                     /product="putative uncharacterized protein"
                     /note="user locus_tag: VANGcI0125c"
     CDS             complement(140482..140934)
                     /product="putative uncharacterized protein"
                     /note="user locus_tag: VANGcI0126c"
     CDS             complement(140927..143422)
                     /product="putative cell wall degradation protein (S-type
                     Pyocin/LysM domain protein)"
                     /note="user locus_tag: VANGcI0127c"
                     /note="Suspicious startcodon believed to be right
                     (supported through PacBio-sequencing); Frequent VA-codons
                     are ATG/Met, GTG/Val, TTG/Leu."
     CDS             complement(143575..143922)
                     /product="putative uncharacterized protein"
                     /note="user locus_tag: VANGcI0128c"
     CDS             complement(144393..145700)
                     /product="putative transcriptional regulator, HipA-like
                     /note="user locus_tag: VANGcI0129c"
                     /note="Similar to Escherichia coli (strain K12) hipa
                     recname: full=protein hipa UniProt:P23874 (EMBL:U00096)
                     (440 aa) fasta scores: E()=4.3e-58, 38.4% id in 430 aa.
                     Probably part of a toxin-antitoxin-TypeII-complex
                     (putative TA pair)? Suspicious startcodon believed to be
                     right (supported through PacBio-sequencing); Frequent
                     VA-codons are ATG/Met, GTG/Val, TTG/Leu."
     CDS             complement(145702..146241)
                     /product="putative uncharacterized
                     /note="user locus_tag: VANGcI0130c"
                     /note="Putative Toxin-Antitoxin-typeII-complex (putative
                     TA pair)"
     CDS             146348..146557
                     /product="Putative lambda repressor-like, DNA-binding
                     /note="user locus_tag: VANGcI0131"
     CDS             146709..147368
                     /product="putative uncharacterized (membrane) protein"
                     /note="user locus_tag: VANGcI0132"
     misc_feature    join(146745..146813,146979..147047)
                     /note="2 probable transmembrane helices predicted for
                     TVA3655 by TMHMM2.0 at aa 13-35 and 91-113"
     CDS             147372..147914
                     /product="putative uncharacterized protein"
                     /note="user locus_tag: VANGcI0133"
     CDS             147911..148984
                     /product="putative uncharacterized protein"
                     /note="user locus_tag: VANGcI0134"
     CDS             complement(148964..149587)
                     /product="putative uncharacterized protein"
                     /note="user locus_tag: VANGcI0135c"
     CDS             150289..152118
                     /product="vitamin B12 transporter BtuB (outer membrane
                     cobalamin translocator)"
                     /note="user locus_tag: VANGcI0136"
                     /note="Putative outer membrane associated TonB-dependent
     CDS             152164..152853
                     /product="putative uncharacterized (ATP-binding) protein"
                     /note="user locus_tag: VANGcI0137"
     CDS             152884..153687
                     /product="glutamate racemase"
                     /note="user locus_tag: VANGcI0138"
                     /note="Ref: P22634 MURI_ECOLI. Suspicious startcodon
                     believed to be right (supported through
                     PacBio-sequencing); Frequent VA-codons are ATG/Met,
                     GTG/Val, TTG/Leu."
     CDS             complement(153650..154105)
                     /product="Putative RNA-binding protein"
                     /note="user locus_tag: VANGcI0139c"
     misc_feature    complement(153983..154087)
                     /note="1 probable transmembrane helix predicted for
                     TVA3648 by TMHMM2.0 at aa 7-41"
     rRNA            154714..156271
                     /product="16S rRNA"
                     /note="16S ribosomal RNA with irregular 3'end, affecting
                     the terminal loop domain 4 (V10). There are minor
                     compensating differences and a (4+10) nt insertion between
                     1.428-1.473 [in positions 1.428/1.429,
                     1.439,1.449(+4/tttc/+10), 1.455, 1.464 and 1.472/73]; in
                     total 1.558 vs normally 1.544 bp."
     tRNA            156336..156408
                     /note="tRNA Ala, anticodon GGC, Cove score 67,09"
     rRNA            156710..159600
                     /product="23S rRNA"
                     /note="23S ribosomal RNA"
     rRNA            159686..159805
                     /product="5S rRNA"
                     /note="5S ribosomal RNA"
     misc_RNA        159938..160171
                     /note="rRNA operon-start (pre 16S);
     rRNA            160172..161715
                     /product="16S rRNA"
                     /note="16S ribosomal RNA (sequence checked and believed to
                     be right, based on 454- AND PacBio-sequencing)"
     tRNA            161807..161876
                     /note="tRNA Glu, anticodon TTC, Cove score 48,40"
     tRNA            161899..161971
                     /note="tRNA Lys, anticodon TTT, Cove score 87,60"
     tRNA            162006..162078
                     /note="tRNA Ala, anticodon TGC, Cove score 73,35"
     tRNA            162113..162185
                     /note="tRNA Val, anticodon TAC, Cove score 77,52"
     rRNA            162547..165437
                     /product="23S rRNA"
                     /note="23S rRNA subunit"
     rRNA            165523..165642
                     /product="5S rRNA"
                     /note="5S ribosomal RNA"
     tRNA            165671..165746
                     /note="tRNA Asp anticodon GTC, Cove score 86,63"
     CDS             complement(165945..166949)
                     /product="Adenosine deaminase"
                     /note="user locus_tag: VANGcI0140c"
                     /note="Similar to Vibrio cholerae serotype O1 (strain ATCC
                     39541/Ogawa 395/O395) add recname: full=adenosine
                     deaminase ec= altname: full=adenosine
                     aminohydrolase UniProt:A5F4Q2 (EMBL:CP000627) (334 aa)
                     fasta scores: E()=5.2e-120, 88.3% id in 333 aa"
     CDS             complement(167041..169590)
                     /product="Putative uncharacterized signal protein
                     (GGDEF/EAL family)"
                     /note="user locus_tag: VANGcI0141c"
     CDS             complement(169696..171099)
                     /product="Nitrogen regulation protein NR(I)"
                     /note="user locus_tag: VANGcI0142c"
                     /note="Similar to Vibrio cholerae serotype O1 (strain ATCC
                     39541/Ogawa 395/O395) ntrc subname: full=nitrogen
                     regulation protein nr(i) UniProt:A5F4Q0 (EMBL:CP000627)
                     (468 aa) fasta scores: E()=2e-159, 90.4% id in 467 aa"
     CDS             complement(171139..172185)
                     /product="Sensor protein. Suspicious startcodon believed
                     to be right (supported through PacBio-sequencing);
                     Frequent VA-codons are ATG/Met, GTG/Val, TTG/Leu."
                     /note="user locus_tag: VANGcI0143c"
                     /note="Similar to Vibrio parahaemolyticus recname:
                     full=sensor protein ec= UniProt:Q87TF0
                     (EMBL:BA000031) (348 aa) fasta scores: E()=8.7e-114, 86.5%
                     id in 348 aa"
     CDS             complement(172320..172835)
                     /product="Putative uncharacterized protein"
                     /note="user locus_tag: VANGcI0144c"
     CDS             complement(173050..174459)
                     /product="glutamine synthetase"
                     /note="user locus_tag: VANGcI0145c"
     CDS             174960..176783
                     /product="putative elongation factor Tu, GTP binding
                     /product="GTP-binding protein TypA"
                     /note="user locus_tag: VANGcI0146"
                     /note="Similar to Escherichia coli GTP-binding protein
                     TypA/BipA (Tyrosine phosphorylated protein A)
                     UniProt:P32132 (607 aa) fasta scores: E()=1.6e-162,
                     74.503% id in 604 aa. Expression may be stress-induced"
     CDS             176917..177831
                     /product="UPF0761 family membrane protein"
                     /note="user locus_tag: VANGcI0147"
                     /note="Contains 6 predicted transmembrane helixes
                     (TMHMM2.0.model). Suspicious startcodon believed to be
                     right (supported through PacBio-sequencing); Frequent
                     VA-codons are ATG/Met, GTG/Val, TTG/Leu."
     misc_feature    join(177004..177072,177199..177258,177325..177393,
                     /note="6 probable transmembrane helices predicted for
                     TVA0567 by TMHMM2.0 at aa 30-52, 95-114, 137-159,
                     174-196,203-220 and 240-262"
     CDS             177803..178237
                     /product="D-tyrosyl-tRNA(tyr) deacylase"
                     /function="D-amino acid catabolic process; hydrolase
                     activity, acting on ester bonds."
                     /note="user locus_tag: VANGcI0148"
                     /note="Similar to Vibrio cholerae serotype O1 (strain ATCC
                     39541/Ogawa 395/O395) dtd recname:
                     full=d-tyrosyl-trna(tyr) deacylase
                     ec=3.1.-.-UniProt:A5F4Q7 (EMBL:CP000627) (144 aa) fasta
                     scores: E()=7.4e-49, 86.0% id in 143 aa"
     CDS             178310..179242
                     /product="Putative uncharacterized protein"
                     /note="user locus_tag: VANGcI0149"
     CDS             complement(179203..181137)
                     /product="Putative uncharacterized protein"
                     /note="user locus_tag: VANGcI0150c"
     misc_feature    complement(181057..181125)
                     /note="1 probable transmembrane helix predicted for
                     TVA0564 by TMHMM2.0 at aa 5-27"
     CDS             complement(181245..182873)
                     /product="phosphoenolpyruvate carboxykinase"
                     /note="user locus_tag: VANGcI0151c"
     CDS             complement(183211..184086)
                     /product="33 kDa chaperonin altname: full=heat shock
                     protein 33 homolog short=hsp33"
                     /note="user locus_tag: VANGcI0152c"
                     /note="Similar to Vibrio parahaemolyticus hslo recname:
                     full=33 kda chaperonin altname: full=heat shock protein 33
                     homolog short=hsp33 UniProt:Q87TE0 (EMBL:BA000031) (291
                     aa) fasta scores: E()=2.9e-100, 80.1% id in 291 aa"
     CDS             complement(184118..184504)
                     /product="Heat shock protein 15"
                     /function="Involved in the recycling of free 50S ribosomal
                     subunits that still carry a nascent chain. Binds RNA more
                     specifically than DNA. Binds with very high affinity to
                     the free 50S ribosomal subunit. Does not bind it when it
                     is part of the 70S ribosome."
                     /note="user locus_tag: VANGcI0153c"
                     /note="Similar to Vibrio cholerae serotype O1 (strain ATCC
                     39541/Ogawa 395/O395) subname: full=heat shock protein 15
                     subname: full=putative uncharacterized protein
                     UniProt:A5F4R8 (EMBL:CP000627) (127 aa) fasta scores:
                     E()=1.5e-33, 68.0% id in 128 aa"
     CDS             184842..185738
                     /product="General secretion pathway protein C"
                     /note="user locus_tag: VANGcI0154"
                     /note="Similar to Vibrio cholerae serotype O1 (strain ATCC
                     39541/Ogawa 395/O395) epsc subname: full=general secretion
                     pathway protein c UniProt:A5F4R7 (EMBL:CP000627) (305 aa)
                     fasta scores: E()=5.7e-66, 62.8% id in 301 aa"
     CDS             185777..187810
                     /product="General secretion pathway protein D"
                     /note="user locus_tag: VANGcI0155"
                     /note="Suspicious startcodon believed to be right
                     (supported through PacBio-sequencing); Frequent VA-codons
                     are ATG/Met, GTG/Val, TTG/Leu. Type II secretion / T2SS."
     CDS             187807..189306
                     /product="General secretion pathway protein E"
                     /note="user locus_tag: VANGcI0156"
     CDS             189306..190526
                     /product="general secretion pathway protein F"
                     /note="user locus_tag: VANGcI0157"
     misc_feature    join(189816..189884,189963..190031,190413..190481)
                     /note="3 probable transmembrane helices predicted for
                     TVA0557 by TMHMM2.0 at aa 171-193, 220-242 and 370-392"
     CDS             190625..191020
                     /product="general secretion pathway protein G"
                     /note="user locus_tag: VANGcI0158"
     CDS             191055..191633
                     /product="General secretion pathway protein H"
                     /note="user locus_tag: VANGcI0159"
                     /note="Similar to Vibrio cholerae serotype O1 (strain ATCC
                     39541/Ogawa 395/O395) epsh subname: full=general secretion
                     pathway protein h UniProt:A5F4R2 (EMBL:CP000627) (194 aa)
                     fasta scores: E()=8.7e-43, 59.2% id in 191 aa"
     misc_feature    191073..191141
                     /note="1 probable transmembrane helix predicted for
                     TVA0555 by TMHMM2.0 at aa 7-29"
     CDS             191626..191979
                     /product="General secretion pathway protein I"
                     /note="user locus_tag: VANGcI0160"
                     /note="Similar to Vibrio cholerae serotype O1 (strain ATCC
                     39541/Ogawa 395/O395) epsi subname: full=general secretion
                     pathway protein I UniProt:A5F4S7 (EMBL:CP000627) (117 aa)
                     fasta scores: E()=3.7e-33, 76.7% id in 116 aa"
     CDS             191966..192619
                     /product="General secretion pathway protein J"
                     /note="user locus_tag: VANGcI0161"
                     /note="Similar to Vibrio cholerae serotype O1 (strain ATCC
                     39541/Ogawa 395/O395) epsj subname: full=general secretion
                     pathway protein j UniProt:A5F4S6 (EMBL:CP000627) (221 aa)
                     fasta scores: E()=4.2e-63, 70.7% id in 215 aa"
     misc_feature    191999..192067
                     /note="1 probable transmembrane helix predicted for
                     TVA0553 by TMHMM2.0 at aa 12-34"
     CDS             192606..193625
                     /product="General secretion pathway protein K"
                     /note="user locus_tag: VANGcI0162"
                     /note="T2SS; Similar to Vibrio cholerae serotype O1
                     (strain ATCC 39541/Ogawa 395/O395) epsk subname:
                     full=general secretion pathway protein k UniProt:A5F4S5
                     (EMBL:CP000627) (336 aa) fasta scores: E()=2.5e-94, 71.1%
                     id in 332 aa"
     misc_feature    192639..192698
                     /note="1 probable transmembrane helix predicted for
                     TVA0552 by TMHMM2.0 at aa 12-31"
     CDS             193594..194805
                     /product="General secretion pathway protein L"
                     /note="user locus_tag: VANGcI0163"
                     /note="T2SS; Suspicious startcodon believed to be right
                     (supported through PacBio-sequencing); Frequent VA-codons
                     are ATG/Met, GTG/Val, TTG/Leu."
     CDS             194816..195313
                     /product="General secretion pathway protein M"
                     /note="user locus_tag: VANGcI0164"
                     /note="Similar to Vibrio cholerae serotype O1 (strain ATCC
                     39541/Ogawa 395/O395) epsm subname: full=cholera toxin
                     secretion protein epsm UniProt:A5F4S3 (EMBL:CP000627) (166
                     aa) fasta scores: E()=6.1e-38, 59.4% id in 165 aa"
     misc_feature    194876..194944
                     /note="1 probable transmembrane helix predicted for
                     TVA0550 by TMHMM2.0 at aa 21-43"
     CDS             195535..196068
                     /product="General secretion pathway protein N"
                     /note="user locus_tag: VANGcI0165"
                     /note="Similar to Vibrio cholerae serotype O1 (strain ATCC
                     39541/Ogawa 395/O395) epsn subname: full=general secretion
                     pathway protein n UniProt:A5F4S2 (EMBL:CP000627) (252 aa)
                     fasta scores: E()=1e-39, 52.0% id in 177 aa"
     CDS             complement(196151..196978)
                     /product="CysQ protein"
                     /note="user locus_tag: VANGcI0166c"
                     /note="Similar to Vibrio parahaemolyticus subname:
                     full=cysq protein UniProt:Q87TC6 (EMBL:BA000031) (275 aa)
                     fasta scores: E()=3.4e-101, 86.9% id in 274 aa"
     CDS             complement(197003..197548)
                     /product="ADP compounds hydrolase NudE"
                     /product="MutT/nudix family protein"
                     /note="user locus_tag: VANGcI0167c"
     CDS             complement(197703..198290)
                     /product="Putative Fe/S biogenesis protein, NfuA
                     /note="user locus_tag: VANGcI0168c"
                     /note="Similar to Escherichia coli Protein gntY
                     UniProt:P63020 (191 aa) fasta scores: E()=2e-54, 78.010%
                     id in 191 aa. Suspicious startcodon believed to be right
                     (supported through PacBio-sequencing); Frequent VA-codons
                     are ATG/Met, GTG/Val, TTG/Leu."
     CDS             complement(198390..199091)
                     /product="ComF-related protein"
                     /note="user locus_tag: VANGcI0169c"
     CDS             199238..200002
                     /product="Carboxylesterase bioH"
                     /note="user locus_tag: VANGcI0170"
                     /note="Similar to Vibrio parahaemolyticus bioh recname:
                     full=carboxylesterase bioh ec= altname: full=biotin
                     synthesis protein bioh UniProt:Q87TC2 (EMBL:BA000031) (255
                     aa) fasta scores: E()=6.6e-67, 66.9% id in 254 aa"
     CDS             200270..200740
                     /product="putative uncharacterized protein"
                     /note="user locus_tag: VANGcI0171"
                     /note="The sequence occurs in Vibrios-species"
     CDS             complement(200890..203220)
                     /product="putative RNA associated protein"
                     /note="user locus_tag: VANGcI0172c"
                     /note="Similar to Escherichia coli S1 RNA binding domain
                     (PDB 1SRO), evalue=5e-09 identity=(31, 75). Expression may
                     be regulated by Fur"
     CDS             203564..204046
                     /product="Transcription elongation factor greB"
                     /note="user locus_tag: VANGcI0173"
                     /note="Similar to Vibrio parahaemolyticus greb recname:
                     full=transcription elongation factor greb altname:
                     full=transcript cleavage factor greb UniProt:Q87TB8
                     (EMBL:BA000031) (163 aa) fasta scores: E()=1.4e-59, 89.9%
                     id in 158 aa"
     CDS             complement(join(204098..204529,204529..205128))
                     /product="Putative uncharacterized protein (pseudogene)"
                     /note="user locus_tag: VANGcI0174c"
                     /note="CDS contains a frameshift after codon 200
                     (pseudogene also in a sister DK_strain)."
     misc_feature    complement(join(204206..204274,204287..204355))
                     /note="2 probable transmembrane helices predicted for
                     TVA0540 by TMHMM2.0 at aa 31-53 and 58-80"
     misc_feature    complement(join(204532..204600,204643..204702,
                     /note="5 probable transmembrane helices predicted for
                     TVA0539 by TMHMM2.0 at aa 10-44, 57-79, 84-106, 143-162
                     and 177-199"
     CDS             complement(205245..205595)
                     /product="Inner membrane protein YdgC"
                     /note="user locus_tag: VANGcI0175c"
                     /note="Similar to Escherichia coli (strain K12) ydgc
                     recname: full=inner membrane protein ydgc UniProt:P0ACX0
                     (EMBL:AP009048) (111 aa) fasta scores: E()=1.1e-16, 47.7%
                     id in 109 aa"
     misc_feature    complement(join(205272..205340,205350..205418,
                     /note="4 probable transmembrane helices predicted for
                     TVA0538 by TMHMM2.0 at aa 2-21, 26-48, 60-82 and 86-108"
     CDS             205756..206514
                     /product="Putative uncharacterized protein"
                     /note="user locus_tag: VANGcI0176"
     CDS             206524..207456
                     /product="Transcriptional regulator, LysR family"
                     /note="user locus_tag: VANGcI0177"
     CDS             complement(207464..207754)
                     /product="Putative uncharacterized protein"
                     /product="Uncharacterized conserved protein"
                     /note="user locus_tag: VANGcI0178c"
     CDS             complement(207758..208411)
                     /product="Oxygen-insensitive NAD(P)H nitroreductase"
                     /note="user locus_tag: VANGcI0179c"
                     /note="Similar to Vibrio cholerae serotype O1 (strain ATCC
                     39541/Ogawa 395/O395) subname: full=oxygen-insensitive
                     nad(p)h nitroreductase UniProt:A5F024 (EMBL:CP000626) (217
                     aa) fasta scores: E()=2.4e-84, 88.9% id in 217 aa"
     CDS             208694..209680
                     /product="Putative uncharacterized protein"
                     /note="user locus_tag: VANGcI0180"
     CDS             210207..213527
                     /product="Putative chitodextrinase"
                     /note="user locus_tag: VANGcI0181"
     CDS             213902..214621
                     /product="response regulator homolog OmpR"
                     /product="Transcriptional regulator OmpR"
                     /function="Member of the two-component regulatory system
                     envZ/ompR involved in the regulation of osmoregulation
                     (genes ompF and ompC). EnvZ functions as a
                     membrane-associated protein kinase that phosphorylates
                     ompR in response to environmental signals."
                     /note="user locus_tag: VANGcI0182"
                     /note="Similar to Vibrio parahaemolyticus subname:
                     full=transcriptional regulator ompr UniProt:Q87TB6
                     (EMBL:BA000031) (239 aa) fasta scores: E()=1.2e-88, 95.0%
                     id in 239 aa"
     CDS             214702..216006
                     /product="Sensor protein"
                     /function="Member of the two-component regulatory system
                     envZ/ompR involved in the regulation of osmoregulation
                     (genes ompF and ompC). EnvZ functions as a
                     membrane-associated protein kinase that phosphorylates
                     ompR in response to environmental signals."
                     /note="user locus_tag: VANGcI0183"
                     /note="Similar to Vibrio cholerae serotype O1 (strain ATCC
                     39541/Ogawa 395/O395) envz recname: full=sensor protein
                     ec= UniProt:A5F4T2 (EMBL:CP000627) (438 aa) fasta
                     scores: E()=1.8e-140, 80.2% id in 434 aa"
     misc_feature    214735..214803
                     /note="1 probable transmembrane helix predicted for
                     TVA0530 by TMHMM2.0 at aa 12-34"
     CDS             complement(216110..217501)
                     /product="membrane permease"
                     /note="user locus_tag: VANGcI0184c"
     misc_feature    complement(join(216161..216220,216263..216316,
                     /note="11 probable transmembrane helices predicted for
                     TVA0529 by TMHMM2.0 at aa 33-55, 83-105, 115-137,
                     149-171,181-203, 210-232, 247-269, 340-362, 367-389,
                     396-413 and 428-447"
     CDS             complement(217720..219810)
                     /product="ATP-dependent DNA helicase RecG"
                     /note="user locus_tag: VANGcI0185c"
                     /note="Similar to Vibrio parahaemolyticus subname:
                     full=atp-dependent dna helicase recg UniProt:Q87TB3
                     (EMBL:BA000031) (693 aa) fasta scores: E()=0, 90.2% id in
                     691 aa"
     CDS             complement(220006..222126)
                     /note="user locus_tag: VANGcI0186c"
     CDS             complement(222166..222438)
                     /product="DNA-directed RNA polymerase subunit omega"
                     /note="user locus_tag: VANGcI0187c"
                     /note="Similar to Vibrio parahaemolyticus serotype O3:K6
                     (strain RIMD 2210633) rpoz recname: full=dna-directed rna
                     polymerase subunit omega short=rnap omega subunit
                     ec= altname: full=rna polymerase omega subunit
                     altname: full=transcriptase subunit omega UniProt:Q87TB0
                     (90 aa) fasta scores: E()=5.9e-30, 96.7% id in 90 aa"
     CDS             complement(222542..223165)
                     /product="5'guanylate kinase"
                     /note="user locus_tag: VANGcI0188c"
     CDS             223557..224231
                     /product="integral membrane protein"
                     /note="user locus_tag: VANGcI0189"
     misc_feature    join(223593..223652,223680..223748,223767..223835,
                     /note="6 probable transmembrane helices predicted for
                     TVA0524 by TMHMM2.0 at aa 13-32, 42-64, 71-93,
                     108-130,142-164 and 184-206"
     CDS             complement(224347..225840)
                     pyrophosphatase (guanosine pentaphosphatase)"
                     /note="user locus_tag: VANGcI0190c"
                     /note="Similar to Vibrio parahaemolyticus serotype O3:K6
                     (strain RIMD 2210633) gppa recname:
                     pyrophosphatase ec= altname: full=guanosine
                     pentaphosphate phosphohydrolase altname:
                     full=pppgpp-5'-phosphohydrolase UniProt:Q87KH4 (497 aa)
                     fasta scores: E()=1.4e-165, 83.6% id in 494 aa"
     CDS             complement(225848..227158)
                     /product="ATP-dependent RNA helicase RhlB"
                     /note="user locus_tag: VANGcI0191c"
                     /note="Similar to Vibrio parahaemolyticus rhlb recname:
                     full=atp-dependent rna helicase rhlb
                     ec=3.6.1.-UniProt:Q87KH5 (EMBL:BA000031) (437 aa) fasta
                     scores: E()=2.3e-163, 91.2% id in 432 aa"
     CDS             227270..227596
                     /product="thioredoxin 1"
                     /note="user locus_tag: VANGcI0192"
                     /note="Similar to Vibrio parahaemolyticus subname:
                     full=thioredoxin UniProt:Q87KH6 (EMBL:BA000031) (108 aa)
                     fasta scores: E()=6.6e-45, 97.2% id in 108 aa"
     CDS             227796..229055
                     /product="transcription termination factor rho"
                     /note="user locus_tag: VANGcI0193"
                     /note="Similar to Vibrio vulnificus subname:
                     full=transcription termination factor rho UniProt:Q8DDN8
                     (EMBL:AE016795) (419 aa) fasta scores: E()=2.1e-156, 95.9%
                     id in 419 aa"
     CDS             229164..230159
                     /product="Putative uncharacterized protein"
                     /note="user locus_tag: VANGcI0194"
     CDS             230237..232093
                     /product="3-octaprenyl-4-hydroxybenzoate carboxy-lyase"
                     /note="user locus_tag: VANGcI0195"
                     /note="Similar to Vibrio parahaemolyticus ubid recname:
                     full=3-octaprenyl-4-hydroxybenzoate carboxy-lyase
                     ec=4.1.1.- altname: full=polyprenyl p-hydroxybenzoate
                     decarboxylase UniProt:Q87KI0 (EMBL:BA000031) (617 aa)
                     fasta scores: E()=0, 79.4% id in 618 aa"
     CDS             232090..232359
                     /note="user locus_tag: VANGcI0196"
                     /note="Similar to Vibrio parahaemolyticus subname:
                     full=ferredoxin UniProt:Q87KI1 (EMBL:BA000031) (89 aa)
                     fasta scores: E()=4.9e-28, 71.9% id in 89 aa"
     CDS             232374..233081
                     /product="NAD(P)H-flavin reductase-fragment"
                     /note="user locus_tag: VANGcI0197"
                     /note="A homopolymeric tract from 4-5-4-sequencing
                     changed,according to a PacBio-sequence (and other refs;
                     otherwise pseudogene-formation)."
     misc_RNA        233390..233623
                     /note="Consensus-sequence, pre16S"
     rRNA            233624..235167
                     /product="16S rRNA"
                     /note="16S ribosomal RNA (sequence checked and believed to
                     be right, based on 454- AND PacBio-sequencing)"
     tRNA            235233..235306
                     /note="tRNA Ile anticodon GAT, Cove score 79,44"
     tRNA            235354..235426
                     /note="tRNA Ala anticodon TGC, Cove score 70,54"
     rRNA            235690..238580
                     /product="23S rRNA"
                     /note="23S ribosomal RNA subunit"
     rRNA            238666..238785
                     /product="5S rRNA"
                     /note="5S ribosomal RNA"
     tRNA            238814..238886
                     /note="tRNA Asp anticodon GTC, Cove score 68,66"
     CDS             complement(239164..240504)
                     /note="user locus_tag: VANGcI0198c"
                     /note="Similar to Escherichia coli (strain K12) pssa
                     recname: full=cdp-diacylglycerol--serine
                     o-phosphatidyltransferase ec= altname:
                     full=phosphatidylserine synthase UniProt:P23830
                     (EMBL:U00096) (451 aa) fasta scores: E()=6.1e-90, 48.0% id
                     in 444 aa"
     CDS             complement(240695..240970)
                     /product="putative uncharacterized protein"
                     /note="user locus_tag: VANGcI0199c"
     misc_feature    complement(240704..240772)
                     /note="1 probable transmembrane helix predicted for
                     TVA3249 by TMHMM2.0 at aa 67-89"
     CDS             241093..242139
                     /product="UDP-N-acetylenolpyruvoylglucosamine reductase"
                     /note="user locus_tag: VANGcI0200"
     CDS             242136..243098
                     /product="bifunctional protein BirA"
                     /note="user locus_tag: VANGcI0201"
                     /note="Similar to Escherichia coli (strain K12) bira
                     recname: full=bifunctional protein bira includes recname:
                     full=biotin operon repressor includes recname:
                     full=biotin--[acetyl-coa-carboxylase] synthetase
                     ec= altname: full=biotin--protein ligase
                     UniProt:P06709 (EMBL:U00096) (321 aa) fasta scores:
                     E()=2.7e-69, 52.5% id in 322 aa"
     CDS             complement(243112..244035)
                     /product="pantothenate kinase (rts protein)"
                     /note="user locus_tag: VANGcI0202c"
                     /note="Similar to Escherichia coli (strain K12) coaa
                     recname: full=pantothenate kinase ec= altname:
                     full=pantothenic acid kinase altname: full=rts protein
                     UniProt:P0A6I3 (EMBL:U00096) (316 aa) fasta scores:
                     E()=2.6e-80, 63.6% id in 308 aa"
     tRNA            244247..244319
                     /note="tRNA Thr anticodon TGT, Cove score 74.78"
     tRNA            244353..244434
                     /note="tRNA Tyr anticodon GTA, Cove score 50.06"
     tRNA            244472..244543
                     /note="tRNA Gly anticodon TCC, Cove score 63.24"
     tRNA            244557..244629
                     /note="tRNA Thr anticodon GGT, length: 73bp, Cove score
     CDS             244734..245918
                     /product="Protein chain elongation factor EF-Tu"
                     /note="user locus_tag: VANGcI0203"
                     /inference="similar to DNA
     CDS             246172..246552
                     /product="preprotein translocase SecE subunit"
                     /note="user locus_tag: VANGcI0204"
                     /note="Similar to Aliivibrio salmonicida (strain LFI1238)
                     (Vibrio salmonicida (strai LFI1238)) sece subname:
                     full=preprotein translocase sece subunit UniProt:B6ENR9
                     (EMBL:FM178379) (125 aa) fasta scores: E()=3e-30, 69.8% id
                     in 126 aa, and to Escherichia coli (strain K12) sece
                     recname: full=preprotein translocase subunit sece
                     UniProt:P0AG96 (EMBL:U00096) (127 aa) fasta scores:
                     E()=3.8e-25, 61.5% id in 122 aa"
     misc_feature    join(246229..246282,246295..246363,246454..246522)
                     /note="3 probable transmembrane helices predicted for
                     TVA3244 by TMHMM2.0 at aa 20-37, 42-64 and 95-117"
     CDS             246565..247113
                     /product="transcription antitermination protein NusG"
                     /note="user locus_tag: VANGcI0205"
     CDS             247247..247675
                     /product="50S ribosomal protein L11"
                     /note="user locus_tag: VANGcI0206"
     CDS             247680..248381
                     /product="50S ribosomal protein L1"
                     /note="user locus_tag: VANGcI0207"
     CDS             248670..249158
                     /product="50S ribosomal subunit protein L10"
                     /note="user locus_tag: VANGcI0208"
     CDS             249219..249584
                     /product="50S ribosomal subunit protein L7/L12"
                     /note="user locus_tag: VANGcI0209"
     CDS             249837..253865
                     /product="DNA-directed RNA polymerase, beta-subunit"
                     /note="user locus_tag: VANGcI0210"
     CDS             253945..258147
                     /product="DNA-directed RNA polymerase beta' chain"
                     /note="user locus_tag: VANGcI0211"
     CDS             complement(258238..258726)
                     /product="Regulator of RNA polymerase sigma (70) subunit"
                     /note="user locus_tag: VANGcI0212c"
     CDS             258910..259698
                     /product="NADH pyrophosphatase"
                     /note="user locus_tag: VANGcI0213"
     CDS             259948..261015
                     /product="uroporphyrinogen decarboxylase"
                     /note="user locus_tag: VANGcI0214"
     CDS             261117..261755
                     /product="HTH-type transcriptional regulator, tetR-family"
                     /note="user locus_tag: VANGcI0215"
     CDS             261845..262807
                     /product="putative uncharacterized protein"
                     /note="user locus_tag: VANGcI0216"
     CDS             complement(262845..263996)
                     /product="putative exported peptidase"
                     /note="user locus_tag: VANGcI0217c"
     CDS             complement(264152..265684)
                     phosphoglycerate mutase"
                     /note="user locus_tag: VANGcI0218c"
     CDS             complement(265841..266728)
                     /product="integral membrane protein"
                     /note="user locus_tag: VANGcI0219c"
     misc_feature    complement(join(265847..265900,265919..265987,
                     /note="10 probable transmembrane helices predicted for
                     TVA3229 by TMHMM2.0 at aa 5-23, 36-58, 64-86,
                     93-112,122-139, 152-174, 189-208, 221-243, 248-270 and
     CDS             complement(266841..268721)
                     /product="methyl-accepting chemotaxis protein"
                     /note="user locus_tag: VANGcI0220c"
     misc_feature    complement(join(267840..267908,268635..268694))
                     /note="2 probable transmembrane helices predicted for
                     TVA3228 by TMHMM2.0 at aa 10-29 and 272-294"
     CDS             complement(269019..270434)
                     /product="putative sodium/sulphate symporter"
                     /note="user locus_tag: VANGcI0221c"
     misc_feature    complement(join(269025..269093,269157..269225,
                     /note="12 probable transmembrane helices predicted for
                     TVA3227 by TMHMM2.0 at aa 7-29, 44-66, 101-123,
                     146-180,187-209, 229-251, 276-293, 297-316, 329-351,
                     361-383,404-426 and 448-470"
     CDS             complement(270648..271505)
                     /product="phosphatidylserine decarboxylase proenzyme"
                     /note="user locus_tag: VANGcI0222c"
     CDS             complement(271681..272742)
                     /product="putative GTPase, RsgA"
                     /function="ribosome small subunit-dependent GTPase A"
                     /note="user locus_tag: VANGcI0223c"
     CDS             272897..273442
                     /note="user locus_tag: VANGcI0224"
     misc_RNA        273572..273735
                     /note="dbj|BA000031.2| Vibrio parahaemolyticus RIMD
                     2210633 DNA, chromosome 1, complete 2990112-2989985
                     Features flanking this part of subject sequence: 1996 bp
                     at 5' side: iron-sulfur cluster-binding protein 112 bp at
                     3' side: oligoribonuclease"
     tRNA            273849..273921
                     /note="tRNA Met anticodon CAT, Cove score 70,81"
     tRNA            273958..274030
                     /note="tRNA Gly anticodon GCC, Cove score 76,03"
     tRNA            274183..274256
                     /note="tRNA Met anticodon CAT, Cove score 70,81"
     tRNA            274293..274365
                     /note="tRNA Gly anticodon GCC, Cove score 76,03"
     tRNA            274466..274538
                     /note="tRNA Met anticodon CAT, Cove score 70,81"
     tRNA            274575..274647
                     /note="tRNA Gly anticodon GCC, Cove score 76,03"
     tRNA            274708..274781
                     /note="tRNA Met anticodon CAT, Cove score 70,81"
     CDS             complement(275444..276574)
                     /product="putative ferredoxin, iron-sulfur cluster-binding
                     /note="user locus_tag: VANGcI0225c"
     CDS             276795..277259
                     /product="putative uncharacterized protein"
                     /note="user locus_tag: VANGcI0226"
     CDS             277253..278974
                     /product="N-acetylmuramoyl-L-alanine amidase"
                     /note="user locus_tag: VANGcI0227"
                     /note="Ref: P26365 AMIB_ECOLI"
     CDS             278983..280959
                     /product="DNA mismatch repair protein mutL"
                     /note="user locus_tag: VANGcI0228"
                     /note="Similar to Escherichia coli (strain K12) mutl
                     recname: full=dna mismatch repair protein mutl
                     UniProt:P23367 (EMBL:U00096) (615 aa) fasta scores:
                     E()=1.2e-92, 49.0% id in 659 aa"
     CDS             280972..281922
                     /product="tRNA dimethylallyltransferase"
                     /note="user locus_tag: VANGcI0229"
                     /note="Similar to Escherichia coli (strain K12) miaa
                     recname: full=trna dimethylallyltransferase ec=
                     altname: full=isopentenyl-diphosphate:trna
                     isopentenyltransferase short=ipp transferase short=iptase
                     short=ippt altname: full=dimethylallyl diphosphate:trna
                     dimethylallyltransferase short=dmapp:trna
                     dimethylallyltransferase short=dmatase UniProt:P16384
                     (EMBL:U00096) (316 aa) fasta scores: E()=6.6e-86, 71.4% id
                     in 304 aa"
     CDS             282104..282370
                     /product="protein Hfq (RNA chaperone)"
                     /function="RNA chaperone that binds small regulatory RNA
                     (sRNAs) and mRNAs to facilitate mRNA translational
                     regulation in response to envelope stress, environmental
                     stress and changes in metabolite concentrations. Also
                     binds with high specificity to tRNAs (By similarity)."
                     /note="user locus_tag: VANGcI0230"
     CDS             282412..283701
                     /product="HflX protein, putative GTP-binding protein"
                     /note="user locus_tag: VANGcI0231"
     CDS             283747..284940
                     /product="HflK protein"
                     /note="user locus_tag: VANGcI0232"
     misc_feature    283933..284001
                     /note="1 probable transmembrane helix predicted for
                     TVA3492 by TMHMM2.0 at aa 63-85"
     CDS             284943..285923
                     /product="protein HflC"
                     /note="user locus_tag: VANGcI0233"
     misc_feature    284955..285014
                     /note="1 probable transmembrane helix predicted for
                     TVA3491 by TMHMM2.0 at aa 5-24"
     CDS             complement(286232..286459)
                     /product="Protein slyX homolog"
                     /note="user locus_tag: VANGcI0234c"
     CDS             complement(286462..287397)
                     /product="putative uncharacterized protein"
                     /note="user locus_tag: VANGcI0235c"
     CDS             287582..288370
                     /product="FKBP-type peptidyl-prolyl cis-trans isomerase
                     /note="user locus_tag: VANGcI0236"
     CDS             288556..289275
                     /product="putative uncharacterized protein"
                     /note="user locus_tag: VANGcI0237"
     CDS             289269..289673
                     /product="sulfurtransferase TusD"
                     /function="Part of a sulfur-relay system required for
                     2-thiolation of 5-methylaminomethyl-2-thiouridine
                     (mnm5s2U) at tRNA wobble positions. Accepts sulfur from
                     tusA and transfers it in turn to tusE. IPR003787: Four
                     small,soluble proteins (DsrE, DsrF, DsrH and DsrC) are
                     encoded in the dsr gene region of the phototrophic sulphur
                     bacterium Chromatium vinosum D. The dsrAB genes encoding
                     dissimilatory sulphite reductase are part of the gene
                     cluster, dsrABEFHCMK. The remaining proteins that are
                     encoded are a transmembrane protein (DsrM) with similarity
                     to haem-b-binding polypeptides and a soluble protein
                     (DsrK) resembling [4Fe-4S]-cluster-containing
                     heterodisulphide reductase from methanogenic archaea. DsrE
                     is a small soluble protein involved in intracellular
                     sulphur reduction (PUBMED:9695921)."
                     /note="user locus_tag: VANGcI0238"
                     /note="Similar to Escherichia coli (strain K12) tusd
                     recname: full=sulfurtransferase tusd ec=2.8.1.- altname:
                     full=trna 2-thiouridine synthesizing protein d
                     UniProt:P45532 (EMBL:U00096) (128 aa) fasta scores:
                     E()=3.9e-28, 56.2% id in 128 aa"
     CDS             289798..290025
                     /product="putative uncharacterized protein"
                     /note="user locus_tag: VANGcI0239"
     CDS             290035..290310
                     /product="putative uncharacterized protein"
                     /note="user locus_tag: VANGcI0240"
     CDS             290493..290867
                     /product="30S ribosomal protein S12"
                     /note="user locus_tag: VANGcI0241"
     CDS             290964..291434
                     /product="30S ribosomal protein S7"
                     /note="user locus_tag: VANGcI0242"
     CDS             291510..293606
                     /product="Translation elongation factor EFG/EF2, GTP
                     binding domain"
                     /note="user locus_tag: VANGcI0243"
                     /note="P0A6M8|EFG_ECOLI Elongation factor G OS=Escherichia
                     coli (strain K12) GN=fusA PE=1 SV=2; evidence at protein
                     /inference="similar to DNA sequence:EcoGene:EG10360"
     CDS             293730..294914
                     /product="Protein chain elongation factor EF-Tu
                     /note="user locus_tag: VANGcI0244"
                     /inference="similar to DNA
     CDS             295126..295494
                     /product="30S ribosomal protein S6"
                     /note="user locus_tag: VANGcI0245"
     CDS             295515..295805
                     /product="primosomal replication protein N"
                     /note="user locus_tag: VANGcI0246"
     CDS             295822..296049
                     /product="30S ribosomal subunit protein S18"
                     /note="user locus_tag: VANGcI0247"
     CDS             296083..296532
                     /product="50S ribosomal protein l9"
                     /note="user locus_tag: VANGcI0248"
                     /note="Similar to Escherichia coli (strain K12) rpli
                     recname: full=50s ribosomal protein l9 UniProt:P0A7R1
                     (EMBL:U00096) (149 aa) fasta scores: E()=2e-38, 74.5% id
                     in 149 aa"
     CDS             complement(296597..297322)
                     /product="putative uncharacterized protein"
                     /note="user locus_tag: VANGcI0249c"
     CDS             297537..298943
                     /product="replicative DNA helicase"
                     /note="user locus_tag: VANGcI0250"
     CDS             298915..300030
                     /product="alanine racemase"
                     /note="user locus_tag: VANGcI0251"
     CDS             300252..301904
                     /product="glucose-6-phosphate isomerase"
                     /note="user locus_tag: VANGcI0252"
     repeat_region   complement(301922..304302)
                     /note="NB10_ISVa5 (2.381 bp; complete); three-orf
     CDS             complement(301954..303495)
                     /product="transposase, ISVa5 (orfC; IS66-family)"
                     /note="user locus_tag: VANGcI0253c"
                     /note="Transposase, ISVa5 (IS66-family; 513aa)"
     CDS             complement(303555..303908)
                     /product="transposase, ISVa5 (orfB; IS66-family)"
                     /note="user locus_tag: VANGcI0254c"
                     /note="Transposase, ISVa5 (IS66-family; 117aa)"
     CDS             complement(303905..304222)
                     /product="transposase, ISVa5 (orfA; IS66-family)"
                     /note="user locus_tag: VANGcI0255c"
                     /note="Transposase, ISVa5 (IS66-family; 105aa)"
     CDS             complement(304390..304851)
                     /product="putative chemotaxis protein"
                     /note="user locus_tag: VANGcI0256c"
     CDS             complement(304870..305334)
                     /product="Ferric-uptake regulation protein"
                     /note="user locus_tag: VANGcI0257c"
     CDS             305580..306560
                     /product="tRNA-dihydrouridine synthase A"
                     /note="user locus_tag: VANGcI0258"
     CDS             306772..306981
                     /product="Putative phage shock protein G"
                     /note="user locus_tag: VANGcI0259"
     misc_feature    join(306790..306858,306886..306954)
                     /note="2 probable transmembrane helices predicted for
                     TVA3620 by TMHMM2.0 at aa 7-29 and 39-61"
     CDS             307081..307737
                     /product="putative uncharacterized (exported) protein"
                     /note="user locus_tag: VANGcI0260"
     CDS             307904..308134
                     /product="putative uncharacterized protein"
                     /note="user locus_tag: VANGcI0261"
     CDS             308231..310084
                     /product="sulfite reductase [NADPH] flavoprotein
                     /note="user locus_tag: VANGcI0262"
     CDS             310084..311817
                     /product="sulfite reductase [NADPH] hemoprotein
                     /note="user locus_tag: VANGcI0263"
     CDS             311810..312562
                     /product="phosphoadenosine phosphosulfate reductase"
                     /note="user locus_tag: VANGcI0264"
     misc_RNA        312988..313221
                     /note="Consensus-sequence, upstream of 16S/5'end"
     rRNA            313222..314765
                     /product="16S rRNA"
                     /note="16S ribosomal RNA (sequence checked and believed to
                     be right, based on 454- AND PacBio-sequencing)"
     tRNA            314831..314907
                     /note="tRNA Ile anticodon GAT, Cove score 92,18"
     tRNA            314953..315027
                     /note="tRNA Ala anticodon TGC, Cove score 75,36"
     misc_RNA        315045..315082
                     /note="The sequence:
                     from other 16S-23S internal transgenic spacers (ITS) rRNAs
                     in the genome."
     rRNA            315326..318216
                     /product="23S rRNA"
                     /note="23S ribosomal RNA subunit"
     rRNA            318302..318421
                     /product="5S rRNA"
                     /note="5S ribosomal RNA"
     tRNA            318450..318525
                     /note="tRNA Asp anticodon GTC, Cove score 86,63"
     CDS             complement(319053..320333)
                     /product="sodium/proton antiporter"
                     /note="user locus_tag: VANGcI0265c"
                     /note="The CDS contains 12 predicted transmembrane
                     helixes,and may be truncated at the C-terminus versus
     misc_feature    complement(join(319089..319157,319200..319268,
                     /note="12 probable transmembrane helices predicted for
                     TVA2305 by TMHMM2.0 at aa 2-19, 24-46, 66-88,
                     98-120,132-154, 179-201, 208-227, 247-269, 289-311,
                     321-343,356-378 and 393-415"
     CDS             320516..324193
                     /product="B12-dependent methionine synthase"
                     /note="user locus_tag: VANGcI0266"
     CDS             complement(324260..325612)
                     /note="user locus_tag: VANGcI0267c"
     CDS             326076..327197
                     /product="aminotransferase, class V"
                     /note="user locus_tag: VANGcI0268"
     CDS             328048..328443
                     /product="putative uncharacterized (aldolase) protein"
                     /note="user locus_tag: VANGcI0269"
     CDS             328616..329986
                     /product="divalent cation transporter"
                     /note="user locus_tag: VANGcI0270"
     misc_feature    join(329480..329539,329549..329617,329702..329770,
                     /note="5 probable transmembrane helices predicted for
                     TVA2300 by TMHMM2.0 at aa 289-308, 312-334,
                     363-385,389-411 and 424-446"
     CDS             complement(330100..331860)
                     /product="O-antigen polymerase"
                     /note="user locus_tag: VANGcI0271c"
     misc_feature    complement(join(330469..330537,330592..330645,
                     /note="13 probable transmembrane helices predicted for
                     TVA2299 by TMHMM2.0 at aa 23-40, 55-72, 79-101,
                     111-130,137-159, 183-200, 213-232, 236-253, 260-282,
                     352-374,387-402, 406-423 and 442-464"
     CDS             complement(331928..334348)
                     /product="UvrABC system protein A"
                     /note="user locus_tag: VANGcI0272c"
     CDS             complement(334919..335788)
                     /product="UTP-glucose-1-phosphate uridylyltransferase"
                     /note="user locus_tag: VANGcI0273c"
     CDS             complement(335906..336553)
                     /product="Transcriptional regulator, LuxR family"
                     /note="user locus_tag: VANGcI0274c"
     CDS             336839..337372
                     /product="single-stranded DNA-binding protein"
                     /note="user locus_tag: VANGcI0275"
     CDS             337502..339490
                     /product="Putative membrane associated signaling protein"
                     /product="Putative MSHA biogenesis protein MshH"
                     /note="user locus_tag: VANGcI0276"
     misc_feature    join(337538..337606,337901..337969)
                     /note="2 probable transmembrane helices predicted for
                     TVA2294 by TMHMM2.0 at aa 13-35 and 134-156"
     CDS             339503..340945
                     /product="Putative MSHA biogenesis protein MshI"
                     /note="user locus_tag: VANGcI0277"
     misc_feature    340403..340471
                     /note="1 probable transmembrane helix predicted for
                     TVA2293 by TMHMM2.0 at aa 301-323"
     CDS             340942..341586
                     /product="MSHA biogenesis protein MshJ"
                     /note="user locus_tag: VANGcI0278"
     misc_feature    340999..341067
                     /note="1 probable transmembrane helix predicted for
                     TVA2292 by TMHMM2.0 at aa 20-42"
     CDS             341917..343545
                     /product="MSHA biogenesis protein MshL"
                     /note="user locus_tag: VANGcI0279"
     CDS             343551..344396
                     /product="MSHA biogenesis protein MshM"
                     /note="user locus_tag: VANGcI0280"
     CDS             344393..345508
                     /product="Putative MSHA biogenesis protein MshN"
                     /note="user locus_tag: VANGcI0281"
     misc_feature    344495..344554
                     /note="1 probable transmembrane helix predicted for
                     TVA2289 by TMHMM2.0 at aa 35-54"
     CDS             345498..347222
                     /product="MSHA biogenesis protein MshE"
                     /note="user locus_tag: VANGcI0282"
     CDS             347235..348452
                     /product="MSHA biogenesis protein, MshG"
                     /note="user locus_tag: VANGcI0283"
     misc_feature    join(347754..347822,347892..347960,348360..348428)
                     /note="3 probable transmembrane helices predicted for
                     TVA2287 by TMHMM2.0 at aa 174-196, 220-242 and 376-398"
     CDS             348463..348924
                     /product="Putative MSHA biogenesis protein, MshF"
                     /note="user locus_tag: VANGcI0284"
     misc_feature    348490..348546
                     /note="1 probable transmembrane helix predicted for
                     TVA2286 by TMHMM2.0 at aa 10-28"
     CDS             349020..349595
                     /product="Type IV pilus (MSHA), prepilin-like
                     /note="user locus_tag: VANGcI0285"
     misc_feature    349038..349106
                     /note="1 probable transmembrane helix predicted for
                     TVA2285 by TMHMM2.0 at aa 7-29"
     regulatory      complement(349043..349078)
                     /note="Putative Rho-independant transcriptional
                     terminator: - strand
                     ...[acaaccacaatcACTacgactaattcaACtAAGGAA]...; length=36;
                     score=-21.7 (FindTerm version 2.8.1, from Softberry Inc)"
     CDS             349633..350106
                     /product="Putative mannose-sensitive hemagglutinin A
                     /note="user locus_tag: VANGcI0286"
     misc_feature    349645..349713
                     /note="1 probable transmembrane helix predicted for
                     TVA2284 by TMHMM2.0 at aa 5-27"
     regulatory      350115..350150
                     /note="Rho-independant: + strand
                     ...[gtaaaggccagcATTgctggcctttatTTTATCTAT]...; length=36;
                     score=-21.7 (FindTerm version 2.8.1, from Softberry Inc)"
     CDS             350251..350751
                     /product="Putative pilin protein, MshC"
                     /product="MSHA pilin protein MshC"
                     /note="user locus_tag: VANGcI0287"
     misc_feature    350287..350346
                     /note="1 probable transmembrane helix predicted for
                     TVA2283 by TMHMM2.0 at aa 13-32"
     CDS             350741..351298
                     /product="MSHA pilin protein MshD"
                     /note="user locus_tag: VANGcI0288"
                     /note="Prepilin-type cleavage/methylation, N-terminal"
     misc_feature    350768..350836
                     /note="1 probable transmembrane helix predicted for
                     TVA2282 by TMHMM2.0 at aa 10-32"
     CDS             351298..352068
                     /product="MSHA biogenesis protein MshO"
                     /note="user locus_tag: VANGcI0289"
                     /note="Contains one prokaryotic N-terminal methylation
     misc_feature    351310..351378
                     /note="1 probable transmembrane helix predicted for
                     TVA2281 by TMHMM2.0 at aa 5-27"
     CDS             352043..352468
                     /product="MSHA biogenesis protein, MshP"
                     /note="user locus_tag: VANGcI0290"
     misc_feature    352079..352138
                     /note="1 probable transmembrane helix predicted for
                     TVA2280 by TMHMM2.0 at aa 13-32"
     CDS             352491..356876
                     /product="MSHA biogenesis protein MshQ"
                     /note="user locus_tag: VANGcI0291"
                     /note="Contains a domain belonging to the Concanavalin
                     A-like lectin/glucanases superfamily"
     CDS             357047..358090
                     /product="rod shape-determining protein MreB"
                     /note="user locus_tag: VANGcI0292"
     CDS             358142..359029
                     /product="rod shape-determining protein MreC (precursor)"
                     /note="user locus_tag: VANGcI0293"
     misc_feature    358178..358246
                     /note="1 probable transmembrane helix predicted for
                     TVA2277 by TMHMM2.0 at aa 13-35"
     CDS             359019..359507
                     /product="rod shape-determining protein MreD"
                     /note="user locus_tag: VANGcI0294"
                     /note="Similar to Escherichia coli (strain K12) mred
                     recname: full=rod shape-determining protein mred
                     UniProt:P0ABH4 (162 aa) fasta scores: E()=1.6e-31, 47.8%
                     id in 159 aa"
     misc_feature    join(359031..359099,359235..359303,359328..359396,
                     /note="4 probable transmembrane helices predicted for
                     TVA2276 by TMHMM2.0 at aa 5-27, 73-95, 104-126 and
     CDS             359504..360070
                     /product="putative Maf-like/septum formation protein,
                     /note="user locus_tag: VANGcI0295"
     CDS             360093..361562
                     /product="ribonuclease G"
                     /function="Involved in the processing of the 5'-end of 16S
                     rRNA. Could be involved in chromosome segregation and cell
                     division. It may be one of the components of the
                     cytoplasmic axial filaments bundles or merely regulate the
                     formation of this structure."
                     /note="user locus_tag: VANGcI0296"
                     /note="Similar to Escherichia coli (strain K12) rng
                     recname: full=ribonuclease g short=rnase g
                     ec=3.1.26.-altname: full=cytoplasmic axial filament
                     protein UniProt:P0A9J0 (489 aa) fasta scores:
                     E()=3.6e-161, 79.1% id in 489 aa. It may be one of the
                     components of the cytoplasmic axial filaments bundles or
                     merely regulate the formation of this structure"
     CDS             361573..365457
                     /product="putative uncharacterized membrane associated
                     /note="user locus_tag: VANGcI0297"
                     /note="Similar to Vibrio cholerae serotype O1 (strain ATCC
                     39541/Ogawa 395/O395) subname: full=putative
                     uncharacterized protein UniProt:A5F8R4 (1291 aa) fasta
                     scores: E()=0, 70.9% id in 1279 aa. The CDS contains 1
                     predicted transmembrane helix."
     CDS             365468..366301
                     /product="putative carbon-nitrogen hydrolase"
                     /note="user locus_tag: VANGcI0298"
     CDS             366298..367743
                     /product="protein TldD (homolog)"
                     /function="suppresses the inhibitory activity of the
                     carbon storage regulator (CsrA) in E.coli; KO-ref: P0AGG8
                     /note="user locus_tag: VANGcI0299"
     CDS             complement(367861..369081)
                     /product="Arginine deiminase"
                     /note="user locus_tag: VANGcI0300c"
                     /note="Similar to Pseudomonas aeruginosa arca recname:
                     full=arginine deiminase short=adi ec= altname:
                     full=arginine dihydrolase short=ad UniProt:P13981 (418 aa)
                     fasta scores: E()=1.4e-76, 45.4% id in 410 aa"
     CDS             369768..370193
                     /product="putative uncharacterized protein"
                     /note="user locus_tag: VANGcI0301"
     CDS             370357..371160
                     /product="putative uncharacterized protein"
                     /note="user locus_tag: VANGcI0302"
     CDS             complement(371172..371564)
                     /product="putative uncharacterized (membrane) protein"
                     /note="user locus_tag: VANGcI0303c"
     misc_feature    complement(join(371268..371336,371463..371531))
                     /note="2 probable transmembrane helices predicted for
                     TVA2267 by TMHMM2.0 at aa 12-34 and 77-99"
     CDS             complement(371733..372170)
                     /product="Putative stress protein"
                     /note="user locus_tag: VANGcI0304c"
     CDS             complement(372255..374828)
                     /product="integral membrane transport protein"
                     /note="user locus_tag: VANGcI0305c"
     misc_feature    complement(join(372675..372734,372762..372830,
                     /note="18 probable transmembrane helices predicted for
                     TVA2265 by TMHMM2.0 at aa 33-55, 65-84, 91-113,
                     123-140,147-169, 193-215, 245-267, 317-339, 360-382,
                     392-409,459-481, 515-537, 542-564, 574-596, 603-625,
                     640-662,667-689 and 699-718"
     CDS             complement(375116..376084)
                     /product="putative exported protein"
                     /note="user locus_tag: VANGcI0306c"
     CDS             complement(376548..377021)
                     /product="Arginine repressor"
                     /note="user locus_tag: VANGcI0307c"
                     /inference="similar to DNA
     CDS             377347..378282
                     /product="malate dehydrogenase"
                     /note="user locus_tag: VANGcI0308"
                     /note="Similar to Shewanella oneidensis mdh recname:
                     full=malate dehydrogenase ec= UniProt:P82177
                     (EMBL:AE014299) (311 aa) fasta scores: E()=6.1e-89, 80.1%
                     id in 311 aa"
     CDS             378576..379982
                     /product="putative arginine/ornithine antiporter"
                     /note="user locus_tag: VANGcI0309"
                     /note="Similar to Escherichia coli (strain K12) ydgi
                     recname: full=putative arginine/ornithine antiporter
                     UniProt:P0AAE5 (EMBL:U00096) (460 aa) fasta scores:
                     E()=3.3e-100, 55.9% id in 456 aa"
     misc_feature    join(378588..378656,378684..378743,378846..378914,
                     /note="11 probable transmembrane helices predicted for
                     TVA2261 by TMHMM2.0 at aa 5-27, 37-56, 91-113,
                     123-145,158-180, 205-224, 236-258, 285-307, 362-384,
                     404-426 and 447-464"
     CDS             complement(380080..381051)
                     /product="octaprenyl-diphosphate synthase"
                     /note="user locus_tag: VANGcI0310c"
                     /note="Similar to Escherichia coli (strain K12) ispb
                     recname: full=octaprenyl-diphosphate synthase
                     ec=2.5.1.-altname: full=octaprenyl pyrophosphate synthase
                     short=opp synthase UniProt:P0AD57 (EMBL:U00096) (323 aa)
                     fasta scores: E()=1.5e-88, 70.0% id in 323 aa"
     CDS             381324..381635
                     /product="50S ribosomal protein L21"
                     /note="user locus_tag: VANGcI0311"
     CDS             381657..381914
                     /product="50S ribosomal protein L27"
                     /note="user locus_tag: VANGcI0312"
     CDS             382136..383308
                     /product="Putative GTP-binding protein, GTP1/obg family"
                     /note="user locus_tag: VANGcI0313"
     CDS             383476..384186
                     /product="membrane protein"
                     /note="user locus_tag: VANGcI0314"
     misc_feature    join(383761..383829,383839..383898,383917..383985,
                     /note="5 probable transmembrane helices predicted for
                     TVA2256 by TMHMM2.0 at aa 96-118, 122-141, 148-170,
                     175-197 and 210-232"
     CDS             384198..384662
                     /product="membrane protein"
                     /note="user locus_tag: VANGcI0315"
     misc_feature    join(384231..384299,384342..384410,384447..384515,
                     /note="4 probable transmembrane helices predicted for
                     TVA2255 by TMHMM2.0 at aa 12-34, 49-71, 84-106 and
     CDS             384706..385188
                     /product="dihydrofolate reductase type 3"
                     /note="user locus_tag: VANGcI0316"
                     /note="Similar to Salmonella typhimurium dhfriii recname:
                     full=dihydrofolate reductase type 3 ec= altname:
                     full=dihydrofolate reductase type iii UniProt:P12833
                     (EMBL:J03306) (162 aa) fasta scores: E()=2e-31, 51.0% id
                     in 153 aa"
     CDS             complement(385235..386050)
                     /product="Calcineurin-like phosphoesterase"
                     /note="user locus_tag: VANGcI0317c"
                     /note="Similar to Escherichia coli (strain K12) apah
                     recname: full=bis(5'-nucleosyl)-tetraphosphatase
                     [symmetrical] ec= altname: full=diadenosine
                     tetraphosphatase altname: full=ap4a hydrolase altname:
                     full=diadenosine 5',5'''-p1,p4-tetraphosphate
                     pyrophosphohydrolase UniProt:P05637 (EMBL:U00096) (280 aa)
                     fasta scores: E()=6.2e-65, 54.2% id in 273 aa"
     CDS             complement(386062..386442)
                     /product="Putative protein ApaG"
                     /note="user locus_tag: VANGcI0318c"
     CDS             complement(386503..387309)
                     /product="Ribosomal RNA small subunit methyltransferase A"
                     /note="user locus_tag: VANGcI0319c"
                     /note="Similar to Escherichia coli (strain K12) rsma
                     recname: full=ribosomal rna small subunit
                     methyltransferase a ec=2.1.1.- altname:
                     dimethyltransferase altname: full=16s rrna
                     dimethyladenosine transferase altname: full=16s rrna
                     dimethylase altname: full=high level kasugamycin
                     resistance protein ksga altname: full=kasugamycin
                     dimethyltransferase UniProt:P06992 (EMBL:U00096) (273 aa)
                     fasta scores: E()=3.1e-71, 64.8% id in 264 aa"
     CDS             complement(387323..388315)
                     /product="4-hydroxythreonine-4-phosphate dehydrogenase"
                     /note="user locus_tag: VANGcI0320c"
                     /note="Similar to Escherichia coli (strain K12) pdxa
                     recname: full=4-hydroxythreonine-4-phosphate dehydrogenase
                     ec= altname: full=4-(phosphohydroxy)-l-threonine
                     dehydrogenase UniProt:P19624 (EMBL:U00096) (329 aa) fasta
                     scores: E()=1.2e-79, 62.1% id in 322 aa"
     CDS             complement(388305..389600)
                     /product="survival protein SurA"
                     /note="user locus_tag: VANGcI0321c"
     CDS             complement(389657..392026)
                     /product="organic solvent tolerance protein"
                     /note="user locus_tag: VANGcI0322c"
     CDS             392176..393030
                     /product="DnaJ-like protein DjlA"
                     /function="Regulatory DnaK co-chaperone. Direct
                     interaction between DnaK and DjlA is needed for the
                     induction of the wcaABCDE operon, involved in the
                     synthesis of a colanic acid polysaccharide capsule,
                     possibly through activation of the RcsB/RcsC
                     phosphotransfer signaling pathway. The colanic acid
                     capsule may help the bacterium survive conditions outside
                     the host."
                     /note="user locus_tag: VANGcI0323"
                     /note="Similar to Escherichia coli (strain K12) djla
                     recname: full=dnaj-like protein djla UniProt:P31680
                     (EMBL:U00096) (271 aa) fasta scores: E()=1.7e-51, 53.5% id
                     in 288 aa"
     misc_feature    392194..392262
                     /note="1 probable transmembrane helix predicted for
                     TVA2247 by TMHMM2.0 at aa 7-29"
     tRNA            complement(393155..393227)
                     /note="tRNA Asn anticodon GTT, Cove score 79.11"
     tRNA            complement(393262..393334)
                     /note="tRNA Thr anticodon TGT, Cove score 74.78"
     tRNA            complement(393372..393444)
                     /note="tRNA Asn anticodon GTT, Cove score 79.11"
     tRNA            complement(393463..393535)
                     /note="tRNA Thr anticodon TGT, Cove score 72.08"
     tRNA            complement(393594..393666)
                     /note="tRNA Phe anticodon GAA, Cove score 75.50"
     regulatory      complement(394013..394047)
                     /note="Rho-independant: - strand
                     ...[aaagccaagtctaacgacttggcttttttattacc]...; length=35;
                     score=-16.8 (FindTerm version 2.8.1, from Softberry Inc)"
     tRNA            complement(394056..394128)
                     /note="tRNA Asn anticodon GTT, Cove score 79.11"
     tRNA            complement(394168..394240)
                     /note="tRNA Phe anticodon GAA, Cove score 75.94"
     tRNA            complement(394250..394322)
                     /note="tRNA Thr anticodon TGT, Cove score 74.78"
     tRNA            complement(394381..394453)
                     /note="tRNA Phe anticodon GAA, Cove score 75.50"
     CDS             complement(394560..395690)
                     /product="Membrane-bound lytic murein transglycosylase C"
                     /note="user locus_tag: VANGcI0324c"
     CDS             complement(395769..396041)
                     /product="Putative Fe(2+)-trafficking protein"
                     /note="user locus_tag: VANGcI0325c"
     CDS             complement(396063..397118)
                     /product="A/G-specific adenine glycosylase"
                     /note="user locus_tag: VANGcI0326c"
     CDS             397294..398013
                     /product="tRNA (guanine-n(7)-)-methyltransferase"
                     /note="user locus_tag: VANGcI0327"
     CDS             398157..399077
                     /note="user locus_tag: VANGcI0328"
     CDS             complement(399159..400316)
                     /product="oxygen-independent coproporphyrinogen III
                     oxidase-like protein"
                     /note="user locus_tag: VANGcI0329c"
     CDS             complement(400316..400915)
                     /product="nucleoside-triphosphatase RdgB"
                     /note="user locus_tag: VANGcI0330c"
                     /note="Similar to Escherichia coli (strain K12) rdgb
                     recname: full=nucleoside-triphosphatase rdgb ec=
                     altname: full=nucleoside triphosphate phosphohydrolase
                     short=ntpase UniProt:P52061 (197 aa) fasta scores:
                     E()=8.9e-56, 68.0% id in 194 aa"
     CDS             complement(400928..401359)
                     /product="putative uncharacterized (exported) protein"
                     /note="user locus_tag: VANGcI0331c"
     CDS             complement(401402..401692)
                     /product="putative uncharacterized protein"
                     /note="user locus_tag: VANGcI0332c"
     CDS             complement(401692..402249)
                     /product="Putative membrane protein"
                     /note="user locus_tag: VANGcI0333c"
     misc_feature    complement(join(401704..401772,401899..401967,
                     /note="4 probable transmembrane helices predicted for
                     TVA2236 by TMHMM2.0 at aa 5-27, 66-88, 95-117 and 160-182"
     CDS             complement(402312..403130)
                     /product="pyrroline-5-carboxylate reductase"
                     /note="user locus_tag: VANGcI0334c"
     CDS             complement(403192..403893)
                     /product="putative uncharacterized protein"
                     /note="user locus_tag: VANGcI0335c"
     CDS             403919..404956
                     /product="twitching mobility protein PilT, type II/IV
                     secretion system protein"
                     /note="user locus_tag: VANGcI0336"
     CDS             404967..406073
                     /product="twitching motility protein PilU, type II/IV
                     secretion system protein"
                     /note="user locus_tag: VANGcI0337"
     CDS             complement(406157..406585)
                     /product="putative holliday junction resolvase"
                     /note="user locus_tag: VANGcI0338c"
                     /note="Similar to Escherichia coli yqgf putative holliday
                     junction resolvase (ec 3.1.-.-). UniProt:P0A8I1
                     (EMBL:EC28377) (138 aa) fasta scores: E()=8.2e-32, 68.148%
                     id in 135 aa"
     CDS             complement(406671..407234)
                     /product="putative uncharacterized protein"
                     /note="user locus_tag: VANGcI0339c"
     CDS             complement(407281..408264)
                     /product="glutathione synthetase"
                     /note="user locus_tag: VANGcI0340c"
     CDS             complement(408248..408979)
                     /product="putative uncharacterized protein"
                     /note="user locus_tag: VANGcI0341c"
     CDS             complement(409088..409795)
                     /product="endonuclease I"
                     /note="user locus_tag: VANGcI0342c"
     misc_feature    complement(409709..409777)
                     /note="1 probable transmembrane helix predicted for
                     TVA2227 by TMHMM2.0 at aa 7-29"
     CDS             complement(409927..410427)
                     /product="putative metallopeptidase, SprT family"
                     /note="user locus_tag: VANGcI0343c"
     CDS             complement(410495..411649)
                     /product="S-adenosylmethionine synthetase"
                     /note="user locus_tag: VANGcI0344c"
     CDS             411961..413721
                     /product="transketolase 1"
                     /note="user locus_tag: VANGcI0345"
                     /note="This HMM is designed to capture orthologs of
                     bacterial transketolases. The group includes two from the
                     yeast Saccharomyces cerevisiae but excludes
                     dihydroxyactetone synthases (formaldehyde transketolases)
                     from various yeasts and the even more distant mammalian
                     transketolases. Among the family of thiamine
                     diphosphate-dependent enzymes that includes
                     transketolases,dihydroxyacetone synthases, pyruvate
                     dehydrogenase E1-beta subunits, and
                     deoxyxylulose-5-phosphate synthases,mammalian and
                     bacterial transketolases seem not to be orthologous. .. In
                     heterotrophic organisms, TK provides a link between
                     glycolysis and the pentose phosphate pathway and provides
                     precursors for nucleotide, aromatic amino acid and vitamin
                     biosynthesis. .."
     CDS             complement(414053..414955)
                     /product="ferric-enterobactin regulatory protein, fetR
                     /note="user locus_tag: VANGcI0346c"
     misc_binding    complement(414956..414963)
                     /note="putative (rpoD17) transcriptional factor binding
     regulatory      complement(414979..414987)
                     /note="pre-fetR signal"
     protein_bind    complement(414982..415020)
                     /note="(V. cholerae IrgB) binding site; cfr fetR in V.
                     anguillarum 775 (Naka&Crosa: DOI
     regulatory      complement(415003..415008)
                     /note="pre-fetR signal"
     regulatory      415046..415051
                     /note="pre-fetA signal"
     protein_bind    complement(415063..415095)
                     /note="(V. cholerae) Fur binding site; cfr fetAR in V.
                     anguillarum 775 (Naka&Crosa: DOI
     regulatory      415066..415074
                     /note="pre-fetA signal"
     misc_binding    415078..415085
                     /note="putative (soxS) transcriptional factor binding
     regulatory      415088..415091
                     /note="Shine-Dalgarno sequence"
     CDS             415099..417054
                     /product="ferric-enterobactin outer membrane receptor
                     /note="user locus_tag: VANGcI0347"
                     /note="Identified interactions for eco NBC_000913 E.coli
                     K12 substr MG1655 uid57779 (seq:
                     gtacaTgtCCAGACtcaatCCGCTGAAtgt); uof(=ryhB-regulated fur
                     leader peptide)."
     regulatory      417066..417109
                     /note="Putative Rho-indipendant transcriptional terminator
                     (ARNold-software): ...TGGCTCccgtttggtGAGCCA..."
     CDS             417254..418279
                     /product="erythrose-4-phosphate dehydrogenase"
                     /note="user locus_tag: VANGcI0348"
     CDS             418428..419591
                     /product="phosphoglycerate kinase"
                     /note="user locus_tag: VANGcI0349"
     CDS             419745..420821
                     /product="fructose-bisphosphate aldolase class II"
                     /note="user locus_tag: VANGcI0350"
     CDS             421118..421981
                     /product="Putative small-conductance mechanosensitive
                     (ion) channel"
                     /note="user locus_tag: VANGcI0351"
     misc_feature    join(421202..421270,421325..421393,421421..421489)
                     /note="3 probable transmembrane helices predicted for
                     TVA2199 by TMHMM2.0 at aa 29-51, 70-92 and 102-124"
     CDS             complement(422056..422682)
                     /product="putative lysine efflux permease, LysE family"
                     /note="user locus_tag: VANGcI0352c"
     misc_feature    complement(join(422062..422130,422188..422247,
                     /note="6 probable transmembrane helices predicted for
                     TVA2198 by TMHMM2.0 at aa 4-26, 39-61, 66-85,
                     114-136,146-165 and 185-207"
     CDS             422811..423707
                     /product="Putative transcriptional regulatory protein,
                     LysR family"
                     /note="user locus_tag: VANGcI0353"
     CDS             423810..424502
                     /product="putative uncharacterized (exported) protein"
                     /note="user locus_tag: VANGcI0354"
     CDS             424728..426533
                     /product="Putative membrane associated GGEDEF protein"
                     /note="user locus_tag: VANGcI0355"
     misc_feature    425595..425663
                     /note="1 probable transmembrane helix predicted for
                     TVA2195 by TMHMM2.0 at aa 290-312"
     CDS             complement(426637..428049)
                     /product="pyruvate kinase I"
                     /note="user locus_tag: VANGcI0356c"
     CDS             428474..429235
                     /product="Transcriptional regulator, DeoR family"
                     /note="user locus_tag: VANGcI0357"
     CDS             429323..431155
                     /note="user locus_tag: VANGcI0358"
     CDS             432192..434594
                     /product="Putative uncharacterized (adhesin) protein"
                     /note="user locus_tag: VANGcI0359"
     CDS             complement(434689..436446)
                     /product="Putative hemolysin"
                     /note="user locus_tag: VANGcI0360c"
     CDS             complement(436832..437245)
                     /product="putative peptidyl-tRNA hydrolase (Putative
                     peptide chain release factor)"
                     /note="user locus_tag: VANGcI0361c"
     CDS             437549..438067
                     /product="putative haemolysin co-regulated protein, Hcp"
                     /note="user locus_tag: VANGcI0362"
                     /note="ID(nucl)=84,01%; mismatch=83; gaps=0 vs hcp protein
                     VCA0017 [Vibrio cholerae O1 biovar El Tor str.
                     N16961]_NP232418 chrII"
     CDS             438207..440303
                     /product="putative uncharacterized (phage-related) type
                     /note="user locus_tag: VANGcI0363"
     CDS             440303..441190
                     /product="putative uncharacterized protein"
                     /note="user locus_tag: VANGcI0364"
     CDS             441187..444447
                     /product="putative uncharacterized protein"
                     /note="user locus_tag: VANGcI0365"
     misc_feature    join(443746..443814,443833..443901)
                     /note="2 probable transmembrane helices predicted for
                     TVA2185 by TMHMM2.0 at aa 854-876 and 883-905"
     CDS             444448..445176
                     /product="putative uncharacterized (membrane) protein"
                     /note="user locus_tag: VANGcI0366"
     misc_feature    join(444562..444630,444643..444702,444796..444864)
                     /note="3 probable transmembrane helices predicted for
                     TVA2184 by TMHMM2.0 at aa 39-61, 66-85 and 117-139"
     CDS             445355..445639
                     /product="putative uncharacterized (mambrane) protein"
                     /note="user locus_tag: VANGcI0367"
     CDS             445781..446077
                     /product="putative uncharacterized (stress responsive)
                     /note="user locus_tag: VANGcI0368"
     CDS             446720..447196
                     /product="putative uncharacterized protein"
                     /note="user locus_tag: VANGcI0369"
     CDS             447301..447675
                     /product="putative uncharacterized protein"
                     /note="user locus_tag: VANGcI0370"
     CDS             448066..449286
                     /product="putative uncharacterized protein"
                     /note="user locus_tag: VANGcI0371"
     CDS             449635..450360
                     /product="putative uncharacterized protein"
                     /note="user locus_tag: VANGcI0372"
     CDS             450562..451443
                     /product="putative uncharacterized protein"
                     /note="user locus_tag: VANGcI0373"
     CDS             451440..452863
                     /product="putative uncharacterized protein"
                     /note="user locus_tag: VANGcI0374"
     repeat_region   complement(452864..454121)
                     /note="Repeat region, with two mobile elements/CDS:
                     tva2174 (ISVch4_aa1) and 2175 (ISVch4_aa2)"
     gene            complement(452872..453795)
                     /product="transposase, ISVch4_aa2 (IS3 family)"
                     /note="user locus_tag: VANGcI0375c"
                     /note="open reading frame with non-standard start codon
                     /inference="similar to DNA sequence:ISFinder:ISVch4_aa2"
     CDS             complement(453741..454085)
                     /product="transposase, IS3 family (ISVch4_aa1)"
                     /note="user locus_tag: VANGcI0376c"
     CDS             454251..454784
                     /product="putative uncharacterized protein"
                     /note="user locus_tag: VANGcI0377"
     CDS             454933..455487
                     /product="putative uncharacterized protein"
                     /note="user locus_tag: VANGcI0378"
     CDS             455683..455889
                     /product="putative uncharacterized protein"
                     /note="user locus_tag: VANGcI0379"
     CDS             complement(455953..457080)
                     /product="putative DNA binding protein (transcriptional
                     /note="user locus_tag: VANGcI0380c"
                     /note="HTH_XRE superfamily (in N-terminus); DUF955
                     superfamily; putative TA pair"
     CDS             complement(457073..457756)
                     /product="putative uncharacterized protein"
                     /note="user locus_tag: VANGcI0381c"
                     /note="putative TA pair"
     CDS             458087..458362
                     /product="putative uncharacterized protein"
                     /note="user locus_tag: VANGcI0382"
                     /note="Occuring in 3 other Vibrios, according til N-blast"
     regulatory      458466..458512
                     /note="Putative Rho-independant transcription terminator:
                     ,ref ARNold (based on Erpin- and RNAmotif-programs)."
     CDS             459075..460082
                     /product="putative uncharacterized cell division protein"
                     /note="user locus_tag: VANGcI0383"
                     /note="Phage or prophage related, ref CP4-57 prophage;
                     RNase LS (NBP_417119)"
     CDS             460083..460448
                     /product="putative uncharacterized (prophage) protein"
                     /note="user locus_tag: VANGcI0384"
     CDS             complement(460489..461673)
                     /product="phage integrase family protein"
                     /note="user locus_tag: VANGcI0385c"
                     /note="DNA_BRE superfamily; putative IS91-family IS
     CDS             complement(461684..462046)
                     /product="putative uncharacterized protein"
                     /note="user locus_tag: VANGcI0386c"
     CDS             462236..463258
                     /product="putative uncharacterized protein"
                     /note="user locus_tag: VANGcI0387"
     CDS             463197..463781
                     /product="Putative uncharacterized (phage membrane)
                     /note="user locus_tag: VANGcI0388"
     CDS             464943..466310
                     /product="putative integrase"
                     /note="user locus_tag: VANGcI0389"
     CDS             complement(466789..467565)
                     /product="Putative metallophosphoesterase"
                     /note="user locus_tag: VANGcI0390c"
     CDS             complement(467746..468486)
                     /product="putative transposase subunit, IS21-family
                     /note="user locus_tag: VANGcI0391c"
                     /note="Cfr aa-sequence similarity versus tva 2796; aa no
                     17 from N-terminus different (alanine vs valine)."
     CDS             complement(468498..470030)
                     /product="putative transposase (IS408/IS1162 type)"
                     /note="user locus_tag: VANGcI0392c"
                     /note="Cfr IPR001584 and IPOR017895:
                     Helix-turn-helix,IS408/IS1162 transposase-type; Integrase,
                     catalytic core. ISVch3_aa1??!"
     CDS             470480..470701
                     /product="putative uncharacterized protein"
                     /note="user locus_tag: VANGcI0393"
     CDS             complement(470781..471167)
                     /product="putative uncharacterized protein"
                     /note="user locus_tag: VANGcI0394c"
     CDS             473440..473697
                     /product="putative DNA-binding protein"
                     /note="user locus_tag: VANGcI0395"
     CDS             complement(473694..474032)
                     /product="putative uncharacterized protein"
                     /note="user locus_tag: VANGcI0396c"
                     /note="contains a phage derived protein Gp49-like domain"
     CDS             complement(474315..474842)
                     /product="putative uncharacterized protein"
                     /note="user locus_tag: VANGcI0397c"
     CDS             475503..475826
                     /product="putative uncharacterized protein"
                     /note="user locus_tag: VANGcI0398"
                     /note="hypothetic protein"
     CDS             476440..477039
                     /product="putative resolvase"
                     /note="user locus_tag: VANGcI0399"
                     /note="The CDS contains an N-terminal catalytic and
                     dimerization domain , and a C-terminal helix-turn-helix
                     DNA-binding domain."
     CDS             complement(477412..478725)
                     /product="putative uncharacterized protein"
                     /note="user locus_tag: VANGcI0400c"
     CDS             complement(479152..480147)
                     /product="putative uncharacterized protein"
                     /note="user locus_tag: VANGcI0401c"
     CDS             complement(480150..481925)
                     /product="Putative type I restriction-modification
                     system,S subunit"
                     /note="user locus_tag: VANGcI0402c"
     CDS             complement(join(481925..482158,483416..484672))
                     /product="Type I restriction modification DNA specificity
                     domain (pseudogene)"
                     /note="user locus_tag: VANGcI0403c"
     repeat_region   complement(482159..483414)
                     /note="NB10_ISVa4 (1.254 bp; complete) + TC; two-orf
     gene            complement(482190..483107)
                     /product="Transposase, ISVa4_aa2 (IS3 family)"
                     /note="user locus_tag: VANGcI0404c"
                     /note="open reading frame with non-standard start codon
                     /inference="similar to DNA sequence:ISFinder:ISVa4_aa2"
     CDS             complement(483047..483346)
                     /product="Transposase, IS3 family (ISVa4_aa1)"
                     /note="user locus_tag: VANGcI0405c"
                     /note="ISVa4_aa1, orfA"
                     /inference="similar to DNA sequence:ISFinder:ISVa4_aa1"
     CDS             484838..485236
                     /product="putative uncharacterized protein"
                     /note="user locus_tag: VANGcI0406"
     CDS             485590..485955
                     /product="putative uncharacterized protein"
                     /note="user locus_tag: VANGcI0407"
     CDS             486628..487284
                     /product="DNA methylase family protein"
                     /note="user locus_tag: VANGcI0408"
     CDS             complement(487347..488339)
                     /product="Putative abortive infection bacteriophage
                     resistance protein"
                     /note="user locus_tag: VANGcI0409c"
     CDS             complement(488608..491085)
                     /product="Putative restriction modification enzyme R
                     subunit (Endonuclease)"
                     /note="user locus_tag: VANGcI0410c"
     CDS             complement(491842..492999)
                     /product="putative uncharacterized protein"
                     /note="user locus_tag: VANGcI0411c"
     CDS             493720..494535
                     /product="putative transmembrane protein (restriction
                     endonuclease family)"
                     /note="user locus_tag: VANGcI0412"
     misc_feature    join(493738..493806,493888..493941)
                     /note="2 probable transmembrane helices predicted for
                     TVA2141 by TMHMM2.0 at aa 7-29 and 57-74"
     CDS             494899..496143
                     /product="putative uncharacterized SMC domain-containing
                     protein (N-terminus, pseudogene)"
                     /note="user locus_tag: VANGcI0413"
                     /note="The CDS seem to be truncated at the
                     3'end/C-terminus (cleaved by an IS-element)"
     repeat_region   complement(496144..497399)
                     /note="NB10_ISVa4 (1.254 bp; complete) + TC; two-orf
     gene            complement(496175..497092)
                     /product="Transposase, ISVa4_aa2 (orfB; IS3 family)"
                     /note="user locus_tag: VANGcI0414c"
                     /note="open reading frame with non-standard start codon
                     /inference="similar to DNA sequence:ISFinder:ISVa4_aa2"
     CDS             complement(497032..497331)
                     /product="Transposase, ISVa4_aa1 (IS3 family)"
                     /note="user locus_tag: VANGcI0415c"
                     /note="ISVa4_aa1; orfA"
                     /inference="similar to DNA sequence:ISFinder:ISVa4_aa1"
     CDS             497402..498076
                     /product="putative uncharacterized SMC domain-containing
                     protein (C-terminus, pseudogene)"
                     /note="user locus_tag: VANGcI0416"
                     /note="The CDS seem to be be truncated in N-terminus
                     (cleaved by an IS-element)"
     CDS             498073..499719
                     /product="putative helicase"
                     /note="user locus_tag: VANGcI0417"
     CDS             499900..500712
                     /product="putative uncharacterized protein"
                     /note="user locus_tag: VANGcI0418"
     CDS             complement(500762..501892)
                     /product="putative uncharacterized TA-pair-protein
                     /note="user locus_tag: VANGcI0419c"
                     /note="Occurs in Vibrios (query cover: 100%; Evalue:0,0)"
     CDS             complement(501882..502274)
                     /product="putative uncharacterized TA-pair-protein
                     /note="user locus_tag: VANGcI0420c"
                     /note="Occurs in Vibrios (query cover: 100%; Evalue:0,0)"
     misc_feature    complement(join(502107..502175,502203..502256))
                     /note="2 probable transmembrane helices predicted for
                     TVA2134 by TMHMM2.0 at aa 7-24 and 34-56"
     CDS             complement(502489..503895)
                     /product="putative uncharacterized TA-protein
                     /note="user locus_tag: VANGcI0421c"
                     /note="Contains two HipA-like domains (N-terminal and
                     C-terminal), PF07804/PF07805. Probably part of a
                     toxin-antitoxin-TypeII-complex (putative TA pair)?"
     CDS             complement(503888..504190)
                     /product="HTH-domain protein (TA-complex)"
                     /note="user locus_tag: VANGcI0422c"
                     /note="May be part of a Tox-Antitox-complex (putative TA
     tRNA            complement(504562..504634)
                     /note="tRNA Met anticodon CAT, Cove score 85.19"
     CDS             complement(504778..506634)
                     /product="RNA polymerase sigma factor RpoD (sigma-70)"
                     /note="user locus_tag: VANGcI0423c"
     CDS             complement(506733..508475)
                     /product="DNA primase"
                     /note="user locus_tag: VANGcI0424c"
                     /note="Similar to Escherichia coli (strain K12) dnag
                     recname: full=dna primase ec=2.7.7.- UniProt:P0ABS5 (581
                     aa) fasta scores: E()=8.2e-133, 55.4% id in 583 aa"
     CDS             complement(508571..509014)
                     /product="putative uncharacterized protein"
                     /note="user locus_tag: VANGcI0425c"
     CDS             complement(509044..509259)
                     /product="30s ribosomal protein S21"
                     /note="user locus_tag: VANGcI0426c"
                     /note="Similar to Escherichia coli (strain K12) rpsu
                     recname: full=30s ribosomal protein s21 UniProt:P68679 (71
                     aa) fasta scores: E()=1.6e-22, 87.3% id in 71 aa"
     CDS             509500..510516
                     /product="O-sialoglycoprotein endopeptidase
                     /note="user locus_tag: VANGcI0427"
     CDS             510685..511500
                     /product="Putative beta-ketoadipate enol-lactone
                     /note="user locus_tag: VANGcI0428"
     CDS             complement(511612..512214)
                     /product="Putative glycerol-3-phosphate acyltransferase"
                     /note="user locus_tag: VANGcI0429c"
                     /note="Similar to Escherichia coli (strain K12) plsy
                     recname: full=probable glycerol-3-phosphate
                     acyltransferase altname: full=g3p acyltransferase
                     short=gpat ec= ec=2.3.1.n5 altname:
                     full=lysophosphatidic acid synthase short=lpa synthase
                     UniProt:P60782 (205 aa) fasta scores: E()=1.9e-48, 63.6%
                     id in 195 aa"
     misc_feature    complement(join(511741..511809,511828..511896,
                     /note="4 probable transmembrane helices predicted for
                     TVA2125 by TMHMM2.0 at aa 5-27, 70-92, 107-129 and
     CDS             512402..512755
                     /product="dihydroneopterin aldolase"
                     /note="user locus_tag: VANGcI0430"
                     /note="Similar to Escherichia coli (strain K12) folb
                     recname: full=dihydroneopterin aldolase short=dhna
                     ec= UniProt:P0AC16 (122 aa) fasta scores:
                     E()=3.3e-31, 70.7% id in 116 aa"
     CDS             512752..513243
                     hydroxymethyldihydropteridine pyrophosphokinase"
                     /note="user locus_tag: VANGcI0431"
                     /note="HPPK superfamily"
     CDS             513256..514059
                     /note="user locus_tag: VANGcI0432"
     misc_feature    join(513274..513342,513508..513561,513580..513648,
                     /note="7 probable transmembrane helices predicted for
                     TVA2122 by TMHMM2.0 at aa 7-29, 85-102, 109-131,
                     157-179,186-205, 215-237 and 249-266"
     CDS             514189..514470
                     /product="cell division protein FtsB homolog"
                     /note="user locus_tag: VANGcI0433"
     CDS             514471..515202
                     /product="2-C-methyl-D-erythritol 4-phosphate
                     /note="user locus_tag: VANGcI0434"
                     /note="Bacterial IspD is a nucleotidyl transferase
                     belonging to a large glycosyltransferase family"
     CDS             515195..515680
                     /product="2-C-methyl-D-erythritol 2,4-cyclodiphosphate
                     /note="user locus_tag: VANGcI0435"
                     /note="Involved in the biosynthesis of isopentenyl
                     diphosphate (IPP) and dimethylallyl diphosphate
                     (DMAPP),two major building blocks of isoprenoid compounds.
                     Catalyzes the conversion of
                     4-diphosphocytidyl-2-C-methyl-D-erythritol 2-phosphate
                     (CDP-ME2P) to 2-C-methyl-D-erythritol 2,4-cyclodiphosphate
                     (ME-CPP) with a corresponding release of cytidine
                     5-monophosphate (CMP)"
     regulatory      515826..515831
                     /note="putative -35 signal"
     regulatory      515846..515853
                     /note="Putative promoter, TF:argR2
     regulatory      515847..515855
                     /note="Putative -10 box"
     CDS             515889..516932
                     /product="tRNA pseudouridine synthase D"
                     /function="(bacteria): Responsible for synthesis of
                     pseudouridine from uracil-13 in transfer RNAs (By
                     /note="user locus_tag: VANGcI0436"
     CDS             516945..517691
                     /product="multifunctional protein SurE (stationary-phase
                     survival protein SurE)"
                     /note="user locus_tag: VANGcI0437"
     CDS             517691..518317
                     /product="Protein-L-isoaspartate O-methyltransferase"
                     /note="user locus_tag: VANGcI0438"
     CDS             518350..519255
                     /product="Lipoprotein NlpD"
                     /note="user locus_tag: VANGcI0439"
     CDS             519328..520329
                     /product="RNA polymerase sigma factor (S)"
                     /function="Putative stationary-phase factor, regulator of
                     the swapping between swimming motility or biofilm
                     formation (stimulates adhesion and represses flagellar
                     /note="user locus_tag: VANGcI0440"
     regulatory      520387..520435
                     /note="predicted transcription (Rho-independant)
                     ATTTGTAA (loop:ACTTAAAAT). The ARNold search procedure
                     uses two complementary programs, Erpin (-7.80) and
     CDS             complement(520446..523034)
                     /product="DNA mismatch repair protein MutS"
                     /note="user locus_tag: VANGcI0441c"
     CDS             complement(523277..524170)
                     /product="Putative cysteine synthase"
                     /note="user locus_tag: VANGcI0442c"
     CDS             524381..525382
                     /product="Thiosulfate ABC transporter, periplasmic
                     thiosulfate-binding protein"
                     /note="user locus_tag: VANGcI0443"
                     /note="Similar to Escherichia coli (strain K12) cysp
                     recname: full=thiosulfate-binding protein flags: precursor
                     UniProt:P16700 (338 aa) fasta scores: E()=2.5e-77, 59.3%
                     id in 324 aa"
     CDS             525449..526306
                     /product="Sulfate ABC transporter, permease protein"
                     /note="user locus_tag: VANGcI0444"
     misc_feature    join(525509..525577,525662..525730,525767..525835,
                     /note="6 probable transmembrane helices predicted for
                     TVA2110 by TMHMM2.0 at aa 21-43, 72-94, 107-129,
                     144-166,220-242 and 252-274"
     CDS             526317..527180
                     /product="Sulfate ABC transporter, permease protein"
                     /note="user locus_tag: VANGcI0445"
                     /note="Similar to Escherichia coli (strain K12) cysw
                     recname: full=sulfate transport system permease protein
                     cysw UniProt:P0AEB0 (291 aa) fasta scores:
                     E()=2.1e-65,59.4% id in 271 aa"
     misc_feature    join(526365..526433,526500..526568,526629..526697,
                     /note="6 probable transmembrane helices predicted for
                     TVA2109 by TMHMM2.0 at aa 17-39, 62-84, 105-127,
                     137-159,198-220 and 247-269"
     CDS             527177..528304
                     /product="Sulfate ABC transporter, ATP-binding protein"
                     /note="user locus_tag: VANGcI0446"
                     /note="Similar to Escherichia coli (strain K12) cysa
                     recname: full=sulfate/thiosulfate import atp-binding
                     protein cysa ec= altname:
                     full=sulfate-transporting atpase UniProt:P16676 (365 aa)
                     fasta scores: E()=3.2e-63,53.5% id in 355 aa"
     CDS             528419..528910
                     /product="CinA family protein"
                     /note="user locus_tag: VANGcI0447"
     CDS             529044..530090
                     /product="protein RecA (recombinase A)"
                     /note="user locus_tag: VANGcI0448"
     CDS             530166..530630
                     /product="regulatory protein RecX"
                     /note="user locus_tag: VANGcI0449"
     CDS             530752..533334
                     /product="alanyl-tRNA synthetase"
                     /note="user locus_tag: VANGcI0450"
     CDS             533540..534727
                     /note="user locus_tag: VANGcI0451"
     CDS             534820..535017
                     /product="carbon storage regulator"
                     /note="user locus_tag: VANGcI0452"
     tRNA            535204..535293
                     /note="tRNA Ser anticodon GCT, Cove score 51.84"
     tRNA            535338..535411
                     /note="tRNA Arg anticodon ACG, Cove score 78.59"
     tRNA            535446..535535
                     /note="tRNA Ser anticodon GCT, Cove score 51.84"
     tRNA            535605..535678
                     /note="tRNA Arg anticodon ACG, Cove score 78.21"
     tRNA            535718..535791
                     /note="tRNA Arg anticodon ACG, Cove score 78.59"
     tRNA            535861..535934
                     /note="tRNA Arg anticodon ACG, Cove score 65.67"
     tRNA            536004..536077
                     /note="tRNA Arg anticodon ACG, Cove score 78.21"
     CDS             536432..536707
                     /product="oxaloacetate decarboxylase gamma chain"
                     /note="user locus_tag: VANGcI0453"
     CDS             536738..538516
                     /product="oxaloacetate decarboxylase 2, subunit alpha"
                     /note="user locus_tag: VANGcI0454"
     CDS             538526..539656
                     /product="Oxaloacetate decarboxylase, B1 subunit"
                     /note="user locus_tag: VANGcI0455"
                     /note="oadB superfamily: Na+-transporting
                     methylmalonyl-CoA/oxaloacetate decarboxylase, beta
     misc_feature    join(538562..538630,538649..538708,538751..538819,
                     /note="9 probable transmembrane helices predicted for
                     TVA2100 by TMHMM2.0 at aa 13-35, 42-61, 76-98,
                     105-127,163-181, 211-233, 253-272, 284-306 and 353-375"
     CDS             539774..540724
                     /product="NAD(P)H:quinone oxidoreductase (quinone
                     /note="user locus_tag: VANGcI0456"
     CDS             540718..541179
                     /product="inner membrane protein"
                     /note="user locus_tag: VANGcI0457"
     misc_feature    join(540751..540819,540877..540945,541018..541086,
                     /note="4 probable transmembrane helices predicted for
                     TVA2098 by TMHMM2.0 at aa 12-34, 54-76, 101-123 and
     CDS             541189..544044
                     /product="exported pepdidase, putative zinc protease"
                     /note="user locus_tag: VANGcI0458"
     misc_feature    541201..541269
                     /note="1 probable transmembrane helix predicted for
                     TVA2097 by TMHMM2.0 at aa 5-27"
     CDS             544147..545712
                     /product="glutamate-cysteine ligase"
                     /note="user locus_tag: VANGcI0459"
                     /note="Similar to Escherichia coli (strain K12) gsha
                     recname: full=glutamate--cysteine ligase ec=
                     altname: full=gamma-glutamylcysteine synthetase altname:
                     full=gamma-ecs short=gcs UniProt:P0A6W9 (518 aa) fasta
                     scores: E()=3.5e-124, 55.9% id in 522 aa"
     CDS             545777..546295
                     /product="S-ribosylhomocysteine lyase (AI-2 synthase)"
                     /function="Involved in the synthesis of autoinducer 2
                     (AI-2) which is secreted by bacteria and is used to
                     communicate both the cell density and the metabolic
                     potential of the environment. The regulation of gene
                     expression in response to changes in cell density is
                     called quorum sensing. Catalyzes the transformation of
                     S-ribosylhomocysteine (RHC) to homocysteine (HC) and
                     4,5-dihydroxy-2,3-pentadione (DPD) (By similarity)."
                     /note="user locus_tag: VANGcI0460"
                     /note="Probably involved in quorum sensing"
     CDS             complement(546379..547653)
                     /product="putative transport protein"
                     /note="user locus_tag: VANGcI0461c"
     misc_feature    complement(join(547216..547284,547321..547389,
                     /note="4 probable transmembrane helices predicted for
                     TVA2094 by TMHMM2.0 at aa 4-26, 62-84, 89-111 and 124-146"
     CDS             complement(547737..548531)
                     /product="Putative cytochrome C assembly protein"
                     /note="user locus_tag: VANGcI0462c"
     misc_feature    complement(join(547770..547823,547851..547904,
                     /note="8 probable transmembrane helices predicted for
                     TVA2093 by TMHMM2.0 at aa 19-41, 51-70, 77-99,
                     103-125,138-160, 191-213, 225-242 and 252-269"
     CDS             548834..550216
                     /product="signal recognition particle protein"
                     /note="user locus_tag: VANGcI0463"
     CDS             550431..550679
                     /product="30S ribosomal protein S16"
                     /note="user locus_tag: VANGcI0464"
     CDS             550733..551263
                     /product="16S rRNA processing protein RimM"
                     /note="user locus_tag: VANGcI0465"
     CDS             551291..552037
                     /note="user locus_tag: VANGcI0466"
     CDS             552079..552432
                     /product="50S ribosomal protein L19"
                     /note="user locus_tag: VANGcI0467"
     CDS             complement(552800..553540)
                     /product="UPF0289 protein tva2087"
                     /note="user locus_tag: VANGcI0468c"
     CDS             complement(553573..554181)
                     /product="Dephospho-CoA kinase (dephosphoCoenzyme A
                     /note="user locus_tag: VANGcI0469c"
     CDS             complement(554172..555053)
                     /product="type IV prepilin peptidase PilD (leader
                     peptidase PilD)"
                     /note="user locus_tag: VANGcI0470c"
     misc_feature    complement(join(554217..554285,554319..554387,
                     /note="6 probable transmembrane helices predicted for
                     TVA2085 by TMHMM2.0 at aa 10-32, 124-146, 159-176,
                     181-203,223-245 and 257-279"
     CDS             complement(555092..556318)
                     /product="Type IV pilin biogenesis protein PilC"
                     /note="user locus_tag: VANGcI0471c"
     misc_feature    complement(join(555116..555184,555587..555655,
                     /note="3 probable transmembrane helices predicted for
                     TVA2084 by TMHMM2.0 at aa 173-195, 222-244 and 379-401"
     CDS             complement(556361..558049)
                     /product="Type IV pilus assembly protein PilB"
                     /note="user locus_tag: VANGcI0472c"
     CDS             complement(558059..558484)
                     /product="Fimbrial protein (type IV pilin)"
                     /note="user locus_tag: VANGcI0473c"
                     /note="Similar to Neisseria gonorrhoeae pile1 recname:
                     full=fimbrial protein altname: full=pilin altname:
                     full=ms11 antigen flags: precursor UniProt:P02974 (165 aa)
                     fasta scores: E()=1.3e-10, 37.7% id in 130 aa; and to
                     Vibrio vulnificus pila subname: full=type iv pilin flags:
                     fragment UniProt:B7U2X8 (143 aa) fasta scores:
                     E()=1.4e-40,78.1% id in 137 aa"
     misc_feature    complement(558389..558457)
                     /note="1 probable transmembrane helix predicted for
                     TVA2082 by TMHMM2.0 at aa 10-32"
     CDS             complement(558743..559630)
                     /product="Quinolinate phosphoribosyltransferase
                     /note="user locus_tag: VANGcI0474c"
                     /note="Similar to Escherichia coli (strain K12) nadc
                     recname: full=nicotinate-nucleotide pyrophosphorylase
                     [carboxylating] ec= altname: full=quinolinate
                     phosphoribosyltransferase [decarboxylating] short=qaprtase
                     UniProt:P30011 (297 aa) fasta scores: E()=5.4e-70, 63.0%
                     id in 292 aa"
     CDS             559755..560306
                     /product="1,6-anhydro-N-acetylmuramyl-L-alanine amidase
                     /note="user locus_tag: VANGcI0475"
                     /note="Similar to Citrobacter freundii ampd recname:
                     full=1,6-anhydro-n-acetylmuramyl-l-alanine amidase ampd
                     ec= altname: full=n-acetylmuramoyl-l-alanine
                     amidase UniProt:P82974 (187 aa) fasta scores:
                     E()=1.2e-50,65.4% id in 179 aa"
     CDS             complement(560328..560846)
                     /product="flavodoxin 2"
                     /note="user locus_tag: VANGcI0476c"
     CDS             560999..561907
                     /product="Tyrosine recombinase XerD"
                     /note="user locus_tag: VANGcI0477"
                     /note="Similar to Escherichia coli (strain K12) xerd
                     recname: full=tyrosine recombinase xerd UniProt:P0A8P8
                     (298 aa) fasta scores: E()=9.1e-83, 70.8% id in 298 aa"
     CDS             561921..562694
                     /product="Thiol/disulfide interchange protein DsbC"
                     /note="user locus_tag: VANGcI0478"
     CDS             562736..564475
                     /product="single-stranded-DNA-specific exonuclease RecJ"
                     /note="user locus_tag: VANGcI0479"
                     /note="Similar to Escherichia coli (strain K12) recj
                     recname: full=single-stranded-dna-specific exonuclease
                     recj ec=3.1.-.- UniProt:P21893 (577 aa) fasta scores:
                     E()=4.2e-148, 61.2% id in 575 aa"
     CDS             564937..565704
                     /product="pyruvate dehydrogenase complex repressor"
                     /note="user locus_tag: VANGcI0480"
                     /note="Similar to Escherichia coli (strain K12) pdhr
                     recname: full=pyruvate dehydrogenase complex repressor
                     UniProt:P0ACL9 (254 aa) fasta scores: E()=3.2e-61, 64.9%
                     id in 251 aa"
     CDS             565758..568433
                     /product="pyruvate dehydrogenase E1 component"
                     /note="user locus_tag: VANGcI0481"
                     /note="Similar to Escherichia coli O157:H7 acee recname:
                     full=pyruvate dehydrogenase e1 component ec=
                     UniProt:P0AFG9 (887 aa) fasta scores: E()=0, 72.1% id in
                     894 aa"
     CDS             568452..570335
                     /product="pyruvate dehydrogenase E2 component
                     (dihydrolipoamide acetyltransferase)"
                     /note="user locus_tag: VANGcI0482"
                     /note="Similar to Escherichia coli
                     Dihydrolipoyllysine-residue acetyltransferase component of
                     pyruvat dehydrogenase complex AceF UniProt:P06959
                     (EMBL:V01498) (629 aa) fasta scores: E()=2.1e-128, 71.887%
                     id in 530 aa."
     CDS             570636..572063
                     /product="dihydrolipoamide dehydrogenase"
                     /note="user locus_tag: VANGcI0483"
                     /note="Similar to Escherichia coli (strain K12) lpda
                     recname: full=dihydrolipoyl dehydrogenase ec=
                     altname: full=dihydrolipoamide dehydrogenase altname:
                     full=e3 component of pyruvate and 2-oxoglutarate
                     dehydrogenases complexes altname: full=glycine cleavage
                     system l protein UniProt:P0A9P0 (474 aa) fasta scores:
                     E()=2.6e-159, 89.7% id in 474 aa"
     CDS             complement(572181..572798)
                     /product="vanT (HTH tetR-type DNA-binding domain)"
                     /note="user locus_tag: VANGcI0484c"
                     /note="Similar to Aliivibrio salmonicida (strain LFI1238)
                     (Vibrio salmonicida (strai LFI1238)) litr subname:
                     full=hth-type luminescence regulator litr UniProt:B6ELF1
                     (201 aa) fasta scores: E()=2.8e-53, 61.4% id in 202 aa,
                     and to Vibrio anguillarum (Listonella anguillarum) vant
                     subname: full=vant
                     (205 aa) fasta scores: E()=4.3e-89, 100.0% id in 205 aa"
     CDS             573170..573700
                     /product="hypoxanthine phosphoribosyltransferase (HPRT)"
                     /note="user locus_tag: VANGcI0485"
                     /note="Similar to Escherichia coli (strain K12) hpt
                     recname: full=hypoxanthine phosphoribosyltransferase
                     short=hprt ec= UniProt:P0A9M2 (178 aa) fasta
                     scores: E()=8.6e-50, 74.7% id in 174 aa"