LOCUS       LC801386                 811 bp    DNA     linear   BCT 12-APR-2025
DEFINITION  Sphingomonas sp. STO1 gene for 16S ribosomal RNA, partial sequence.
ACCESSION   LC801386
VERSION     LC801386.1
KEYWORDS    .
SOURCE      Sphingomonas sp.
  ORGANISM  Sphingomonas sp.
            Bacteria; Pseudomonadati; Pseudomonadota; Alphaproteobacteria;
            Sphingomonadales; Sphingomonadaceae; Sphingomonas.
REFERENCE   1  (bases 1 to 811)
  AUTHORS   Kanno,N. and Shigeto,S.
  TITLE     Direct Submission
  JOURNAL   Submitted (04-MAR-2024) to the DDBJ/EMBL/GenBank databases.
            Contact:Nanako Kanno
            Kwansei Gakuin University, Department of Chemistry, School of
            Science; 1 Gakuen Uegahara, Sanda, Hyogo 669-1330, Japan
REFERENCE   2
  AUTHORS   Kanno,N. and Shigeto,S.
  TITLE     Single-cell pigment analysis of phototrophic and phyllosphere
            bacteria using simultaneous detection of Raman and
            autofluorescence spectra
  JOURNAL   Appl. Environ. Microbiol. e00129-25 (2025)
  REMARK    Publication Status: Online-Only
            DOI:10.1128/aem.00129-25
COMMENT     
FEATURES             Location/Qualifiers
     source          1..811
                     /collection_date="2022-08-20"
                     /db_xref="taxon:28214"
                     /geo_loc_name="Japan:Hyogo, Sanda"
                     /isolation_source="leaf surface of Trifolium repens"
                     /mol_type="genomic DNA"
                     /organism="Sphingomonas sp."
                     /PCR_primers="fwd_name: 27F, fwd_seq:
                     agagtttgatcctggctcag, rev_name: 1492R, rev_seq:
                     ggttaccttgttacgactt"
                     /strain="STO1"
     rRNA            <1..>811
                     /product="16S ribosomal RNA"
BASE COUNT          207 a          172 c          262 g          170 t
ORIGIN      
        1 tgcaagtcga acgatgcttt cgggcatagt ggcgcacggg tgcgtaacgc gtgggaatct
       61 gccctttggt tcggaataac agttggaaac gactgctaat accggatgat gacgtaagtc
      121 caaagattta tcgccagagg atgagcccgc gtgagattag gtagttggtg gggtaaaggc
      181 ctaccaagcc gacgatctct agctggtctg agaggatgat cagccacact gggactgaga
      241 cacggcccag actcctacgg gaggcagcag tggggaatat tggacaatgg gcgcaagcct
      301 gatccagcaa tgccgcgtga gtgatgaagg ccttagggtt gtaaagctct tttacccggg
      361 atgataatga cagtaccggg agaataagcc ccggctaact ccgtgccagc agccgcggta
      421 atacggaggg ggctagcgtt gttcggaatt actgggcgta aagcgcacgt aggcggcttt
      481 gtaagttagg ggtgaaagcc tggagctcaa ctccagaatt gcctttaaga ctgcatcgct
      541 tgaatccagg agaggtgagt ggaattccga gtgtagaggt gaaattcgta gatattcgga
      601 agaacaccag tggcgaaggc ggctcactgg actggtattg acgctgaggt gcgaaagcgt
      661 ggggagcaaa caggattaga taccctggta gtccacgccg taaacgatga taactagctg
      721 tccggggact tggtctttgg gtggcgcagc taacgcatta agttatccgc ctggggagta
      781 cggccgcaag gttaaactca aaggaattga c
//