LOCUS LC801386 811 bp DNA linear BCT 12-APR-2025 DEFINITION Sphingomonas sp. STO1 gene for 16S ribosomal RNA, partial sequence. ACCESSION LC801386 VERSION LC801386.1 KEYWORDS . SOURCE Sphingomonas sp. ORGANISM Sphingomonas sp. Bacteria; Pseudomonadati; Pseudomonadota; Alphaproteobacteria; Sphingomonadales; Sphingomonadaceae; Sphingomonas. REFERENCE 1 (bases 1 to 811) AUTHORS Kanno,N. and Shigeto,S. TITLE Direct Submission JOURNAL Submitted (04-MAR-2024) to the DDBJ/EMBL/GenBank databases. Contact:Nanako Kanno Kwansei Gakuin University, Department of Chemistry, School of Science; 1 Gakuen Uegahara, Sanda, Hyogo 669-1330, Japan REFERENCE 2 AUTHORS Kanno,N. and Shigeto,S. TITLE Single-cell pigment analysis of phototrophic and phyllosphere bacteria using simultaneous detection of Raman and autofluorescence spectra JOURNAL Appl. Environ. Microbiol. e00129-25 (2025) REMARK Publication Status: Online-Only DOI:10.1128/aem.00129-25 COMMENT FEATURES Location/Qualifiers source 1..811 /collection_date="2022-08-20" /db_xref="taxon:28214" /geo_loc_name="Japan:Hyogo, Sanda" /isolation_source="leaf surface of Trifolium repens" /mol_type="genomic DNA" /organism="Sphingomonas sp." /PCR_primers="fwd_name: 27F, fwd_seq: agagtttgatcctggctcag, rev_name: 1492R, rev_seq: ggttaccttgttacgactt" /strain="STO1" rRNA <1..>811 /product="16S ribosomal RNA" BASE COUNT 207 a 172 c 262 g 170 t ORIGIN 1 tgcaagtcga acgatgcttt cgggcatagt ggcgcacggg tgcgtaacgc gtgggaatct 61 gccctttggt tcggaataac agttggaaac gactgctaat accggatgat gacgtaagtc 121 caaagattta tcgccagagg atgagcccgc gtgagattag gtagttggtg gggtaaaggc 181 ctaccaagcc gacgatctct agctggtctg agaggatgat cagccacact gggactgaga 241 cacggcccag actcctacgg gaggcagcag tggggaatat tggacaatgg gcgcaagcct 301 gatccagcaa tgccgcgtga gtgatgaagg ccttagggtt gtaaagctct tttacccggg 361 atgataatga cagtaccggg agaataagcc ccggctaact ccgtgccagc agccgcggta 421 atacggaggg ggctagcgtt gttcggaatt actgggcgta aagcgcacgt aggcggcttt 481 gtaagttagg ggtgaaagcc tggagctcaa ctccagaatt gcctttaaga ctgcatcgct 541 tgaatccagg agaggtgagt ggaattccga gtgtagaggt gaaattcgta gatattcgga 601 agaacaccag tggcgaaggc ggctcactgg actggtattg acgctgaggt gcgaaagcgt 661 ggggagcaaa caggattaga taccctggta gtccacgccg taaacgatga taactagctg 721 tccggggact tggtctttgg gtggcgcagc taacgcatta agttatccgc ctggggagta 781 cggccgcaag gttaaactca aaggaattga c //