LOCUS       LC593157                 923 bp    DNA     linear   PLN 07-JAN-2022
DEFINITION  Dysphania pumilio HIRO:HIRO-MY-140486 genes for 18S rRNA, ITS1,
            5.8S rRNA, ITS2, and 28S rRNA, partial and complete sequence.
ACCESSION   LC593157
VERSION     LC593157.1
KEYWORDS    .
SOURCE      Dysphania pumilio
  ORGANISM  Dysphania pumilio
            Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
            Spermatophyta; Magnoliopsida; eudicotyledons; Gunneridae;
            Pentapetalae; Caryophyllales; Chenopodiaceae; Chenopodioideae;
            Dysphanieae; Dysphania.
REFERENCE   1  (bases 1 to 923)
  AUTHORS   Tsubota,H. and Inoue,Y.
  TITLE     Direct Submission
  JOURNAL   Submitted (10-NOV-2020) to the DDBJ/EMBL/GenBank databases.
            Contact:Hiromi Tsubota
            Hiroshima University, Graduate School of Integrated Sciences for
            Life, Miyajima Natural Botanical Garden; 1156-2 Mitsumaruko-yama,
            Miyajima-cho, Hatsukaichi, Hiroshima 739-0543, Japan
            URL    :https://www.digital-museum.hiroshima-u.ac.jp/~main/
REFERENCE   2
  AUTHORS   Phan,Q.C., Nakahara-Tsubota,M., Inoue,Y. and Tsubota,H.
  TITLE     New record of Dysphania pumilio (Amaranthaceae) from Hiroshima
            Prefecture, southwest Japan
  JOURNAL   Hikobia 18, 145-156 (2021)
COMMENT     
FEATURES             Location/Qualifiers
     source          1..923
                     /collected_by="Q. C. Phan & H. Tsubota"
                     /collection_date="2018-09-28"
                     /country="Japan: Hiroshima, Hatsukaichi, Miyajima Island"
                     /db_xref="taxon:434245"
                     /lat_lon="34.3024 N 132.323 E"
                     /mol_type="genomic DNA"
                     /organism="Dysphania pumilio"
                     /PCR_primers="fwd_name: 18S1659B, fwd_seq:
                     cgtcgctcctaccgattg, rev_name: 26S166BR, rev_seq:
                     gaggacgcttctccagactac"
                     /specimen_voucher="HIRO:HIRO-MY-140486"
                     /tissue_type="leaf"
     misc_RNA        <1..>923
                     /note="contains 18S ribosomal RNA, internal transcribed
                     spacer 1, 5.8S ribosomal RNA, internal transcribed spacer
                     2, and 28S ribosomal RNA"
BASE COUNT          213 a          242 c          269 g          199 t
ORIGIN      
        1 aatggtccgg tgaagtgttc ggattgcggc gacgtgggcg gttcgccgcc ggcgacgtcg
       61 caagaagttc actgaacctt atcatttaga ggaaggagaa gtcgtaacaa ggtttccgta
      121 ggtgaacctg cggaaggatc attgtcgaaa cctgcccagc agagcgacca gcgaacatgt
      181 ttatcatgca tgggtgaggg gcccatagtt ttgccttgtg caactctctg gtagcctctc
      241 aacctcgcct agtgggctcc ccttaatggg gcgttctcta ggcacaataa cgaaccccgg
      301 cgtggtctac gccaaggaac atgaatacta gtgtgccccc cttgactggt tttccggaag
      361 aggtggtggc accaagtcgt ataaaacatt aaacgactct cggcaacgga tatctcggct
      421 ctcgcatcga tgaagaacgt agcgaaatgc gatacttggt gtgaattgca gaatcccgtg
      481 aaccatcgag tctttgaacg caagttgcgc ctgaagcctt ttggcagagg gcacgcctgc
      541 ctgggcgtca cgcatcgcgt ctcccccatc ccaccatgcg tgggaaggtg gaggatgatg
      601 gtctcccatg cctcaccggg cgtggatggc ctaaatacgg agcccccggc tgcgagctgc
      661 tgtggcgata ggtggtagac aaggccaagc gccgagtatg catcgcgtca agcagcacgt
      721 tgtccatgag gcctcgcagg acccttattt tctgcctttc ggggcagtat aaaccgttgc
      781 gaccccaggt caggcggggt tacccgctga gtttaagcat atcaataagc ggaggaaaag
      841 aaacttacaa ggattcccct agtaacggcg agcgaaccgg gaatagccca gctttaaaat
      901 cgggcggctt cgctgtccga att
//