LOCUS       KF055287                 266 bp    DNA     linear   VRL 04-SEP-2013
DEFINITION  Epsilonpapillomavirus 1 isolate BL-10 major capsid protein (L1)
            gene, partial cds.
VERSION     KF055287.1
SOURCE      Epsilonpapillomavirus 1
  ORGANISM  Epsilonpapillomavirus 1
            Viruses; dsDNA viruses, no RNA stage; Papillomaviridae;
REFERENCE   1  (bases 1 to 266)
  AUTHORS   Jangir,B.L., Kumar,P. and Somvanshi,R.
  TITLE     BPV-5 in teat wart (fibropapilloma) of a non-descript hill cattle
  JOURNAL   Unpublished
REFERENCE   2  (bases 1 to 266)
  AUTHORS   Jangir,B.L., Kumar,P. and Somvanshi,R.
  TITLE     Direct Submission
  JOURNAL   Submitted (17-MAY-2013) Division of Pathology, Indian Veterinary
            Research Institute, Izatnagar, Bareilly, Uttar Pradesh 243122,
COMMENT     ##Assembly-Data-START##
            Sequencing Technology :: Sanger dideoxy sequencing
FEATURES             Location/Qualifiers
     source          1..266
                     /organism="Epsilonpapillomavirus 1"
                     /mol_type="genomic DNA"
                     /isolation_source="teat wart"
                     /PCR_primers="fwd_name: bpv-5f, fwd_seq:
                     actggctctaccaagctcaagg, rev_name: bpv-5r, rev_seq:
     gene            <1..>266
     CDS             <1..>266
                     /note="mediates virus binding to the cell surface"
                     /product="major capsid protein"
BASE COUNT           79 a           44 c           68 g           75 t
        1 actggctcta ccaagctcaa ggtttaaata acggggtctg ctgggataat gagctattta
       61 ttacagtagg agacaatagt agaggaggag tgtttacaat tagtgttcca gtggatgata
      121 ggaaacctga gcagtacaat agtgccaata tgaatattta ttgcaggcat gtagaggaat
      181 ataagctagc cgttattctg gagctatgta gtgtggagct gacctcagaa accgttgcat
      241 atttgcagac cgttaaccct tctgtc