LOCUS       JN572149                 742 bp    DNA     linear   PLN 17-OCT-2011
DEFINITION  Paeonia suffruticosa isolate MO 18S ribosomal RNA gene, partial
            sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene,
            and internal transcribed spacer 2, complete sequence; and 26S
            ribosomal RNA gene, partial sequence.
ACCESSION   JN572149
VERSION     JN572149.1
KEYWORDS    .
SOURCE      Paeonia suffruticosa (tree peony)
  ORGANISM  Paeonia suffruticosa
            Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
            Spermatophyta; Magnoliophyta; eudicotyledons; Gunneridae;
            Pentapetalae; Saxifragales; Paeoniaceae; Paeonia.
REFERENCE   1  (bases 1 to 742)
  AUTHORS   Sun,Y.-L. and Hong,S.-K.
  TITLE     Genetic diversity and phylogenetics of genus Paeonia based on
            nuclear ribosomal DNA ITS sequence
  JOURNAL   Sigmul Saengmyeong Gong Haghoeji 38, 234-240 (2011)
REFERENCE   2  (bases 1 to 742)
  AUTHORS   Sun,Y.-L. and Hong,S.-K.
  TITLE     Direct Submission
  JOURNAL   Submitted (11-AUG-2011) Department of Bio-Health Technology,
            Kangwon National University, 1#, Chuncheon, Kangwon 200-701, Korea
FEATURES             Location/Qualifiers
     source          1..742
                     /organism="Paeonia suffruticosa"
                     /mol_type="genomic DNA"
                     /isolate="MO"
                     /db_xref="taxon:45171"
                     /country="South Korea"
                     /collected_by="S.K. Hong"
                     /identified_by="Y.L. Sun"
                     /PCR_primers="fwd_name: ITS5, fwd_seq:
                     ggaagtaaaagtcgtaacaagg, rev_name: ITS4, rev_seq:
                     tcctccgcttattgatatgc"
                     /note="authority: Paeonia suffruticosa Andr."
     rRNA            <1..66
                     /product="18S ribosomal RNA"
     misc_RNA        67..331
                     /product="internal transcribed spacer 1"
     rRNA            332..490
                     /product="5.8S ribosomal RNA"
     misc_RNA        491..717
                     /product="internal transcribed spacer 2"
     rRNA            718..>742
                     /product="26S ribosomal RNA"
BASE COUNT          172 a          213 c          202 g          155 t
ORIGIN      
        1 gtttttgata tgtaaaaagt cgtaacaagg tttccgtagg tgaacctgcg gaaggatcat
       61 tgtcgaacct gcctagcaga acgaccagcg aacttgtaaa aatgctcggg ctgagggaag
      121 gcgtgagcct ctccttcatc ccacgtccga tcgcaccaga cgttgagtcg cccctcgcac
      181 gatgtgcagg gaagcgccaa ggttctggtg tgctctcgga tttacaacaa accccggcgc
      241 aaaccgcgcc aaggaactaa aacgaaagag catgcccccg ttgccccgac tttgggatgc
      301 gcgggaggta atgtcttctt ttacatatca aaacgactct cggcaacgga tatctcggct
      361 ctcgcatcga tgaagaacgt agcgaaatgc gatacttggt gtgaattgca gaatcccgtg
      421 aatcaccgag tctttgaacg caagttgcgc ccaaagcctt taggctgagg gcacgtctgc
      481 ctgggcgtca cgtatcccgt cgcaccccca acccgtccca acgcgggcac gatggctggt
      541 gggagcggat attggcctcc cgtgtactcg cgtcgcggtt ggtctaaaat cgagccccga
      601 gcgacgaacg tcacgacaag tggtggtctg taatagctat ttcgtgttgt gcgttgtctc
      661 gtcgcccgtg tgagctcaca aaaaccccag agcatcgtca cgacgatgct ccatcgcgac
      721 cccaggtcag cagaccaccg cc
//