LOCUS JK034265 882 bp mRNA linear EST 07-FEB-2014 DEFINITION 183 (LHA-2011) Bellamya aeruginosa normalized cDNA library Bellamya aeruginosa cDNA 5', mRNA sequence. ACCESSION JK034265 VERSION JK034265.1 DBLINK BioSample: SAMN00622379 KEYWORDS EST. SOURCE Sinotaia aeruginosa ORGANISM Sinotaia aeruginosa Eukaryota; Metazoa; Spiralia; Lophotrochozoa; Mollusca; Gastropoda; Caenogastropoda; Architaenioglossa; Viviparoidea; Viviparidae; Sinotaia. REFERENCE 1 (bases 1 to 882) AUTHORS An,L.H. and Zheng,B.H. TITLE Construction and Characterization of Normalized cDNA Library from the Snail Bellamya aeruginosa Exposure to Copper JOURNAL Unpublished COMMENT Contact: An L.H. State Environmental Protection Key Laboratory Of Estuarine And Coastal Research Chinese Research Academy For Environment Sciences 8 Dayangfang BeiYuan Road, Chaoyang District, Beijing 100012, China Tel: +86-10-84913914 Fax: +86-10-84913914 Email: anlh@craes.org.cn PCR PRimers FORWARD: CTCGGGAAGCGCGCCATTGTGTTGGT BACKWARD: ATACGTCTCACTATAGGGCGAATTGGCC. FEATURES Location/Qualifiers source 1..882 /organism="Sinotaia aeruginosa" /mol_type="mRNA" /db_xref="taxon:2653872" /tissue_type="gonads; digestive gland; peripheral tissue" /clone_lib="SAMN00622379 Bellamya aeruginosa normalized cDNA library" /dev_stage="mature" /note="Vector: Lambda TripEx2; 1.5 microliter RNA solution (1-3 microgram of total RNA) was normalized using CDS and SMART Oligo IV primer firstly, and then the reaction solution was reversed transcription for synthesizing the first-strand using MMLV reverse transcriptase (Promega, USA). Subsequently, PCR reaction was operated and cDNA was extracted using Promegas PCR clean-up system kit (Madison, USA). And then the cDNA library was constructed using SMART cDNA Library Construction Kit. After that, 6000 random clones were sequenced by the ABI3730xl. BLAST homology searches in the nr and nt databases in GenBank were performed for each of the unigenes under Evalues of 1e-5. The unigenes were named after the homologous sequences in GenBank. The annotated unigenes were then matched to specific processes or functions using COG and GO tools." BASE COUNT 230 a 173 c 208 g 271 t ORIGIN 1 tcgacccgtt catagtcaag tccggtcaga ggcggcccga gagctgtgaa ccacgccttt 61 ttccttcctg ttgttgggac cttcgttggt tcgggacttt tgttggttct ccggtttccg 121 gtcttcctag cctccacatg aatttcggca gtgcgggtac accgacacat tgtctcgtga 181 gaagcctgtg cagtggagcg tagagtcggg aactgagaag tttatatgca cgtaaccatc 241 atccaaccag caacttgtag ccagcgcaag gccgggacgc cacacagcga gcgagcgtgt 301 gcatcggacg gcgtgctagt tgacgccagg tcatgtactt tgttgacttt tctatactcc 361 taaaaactct tgttcgatga tgagatagtc gaatttagta tgtgggacag atatcattag 421 agtaaggggt taaaccaatt ttcggaatat tatttttcaa gtgactgttg atttaaattt 481 gtatttgtaa aatctgtata atagttaata aatttatctt ttgttacttt tcattcttct 541 tacgcatacc aaatttcgtt gtatgtctgg agtaatgtgg gtggatgggg gctccttaaa 601 aaatagttga atcaaatcga attactcctt tagtaggaag ttccaccagc gaaccagtat 661 aaattatgtg tccgatgggg gtgtaagctt atcgtgacga gtgaatggaa gtttaaaatc 721 ttacaatttg atcactgatg agcgattatg actgttaatg aaaatagttc ttaaatttaa 781 cagctcataa ttaaggtaca caccaggcgg cgtcacacat tgtctgtaat attctacgtg 841 ggtccaaaac ctgagcagtt gtcgaccatc agcgaagtac tg //