LOCUS       HM567397                 962 bp    DNA     linear   PLN 14-OCT-2010
DEFINITION  Zingiber officinale clone Padi tRNA-Leu (trnL) gene, partial
            sequence; trnL-trnF intergenic spacer, complete sequence; and
            tRNA-Phe (trnF) gene, partial sequence; chloroplast.
ACCESSION   HM567397
VERSION     HM567397.1
KEYWORDS    .
SOURCE      chloroplast Zingiber officinale
  ORGANISM  Zingiber officinale
            Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
            Spermatophyta; Magnoliophyta; Liliopsida; Zingiberales;
            Zingiberaceae; Zingiber.
REFERENCE   1  (bases 1 to 962)
  AUTHORS   Valdiani,A.R., Sagineedu,S.R. and Pichika,M.R.
  TITLE     Phylogenetic Analysis and Classification of Malaysian Ginger
            (Zingiber officinale Rosc.)
  JOURNAL   Unpublished
REFERENCE   2  (bases 1 to 962)
  AUTHORS   Valdiani,A.R., Sagineedu,S.R. and Pichika,M.R.
  TITLE     Direct Submission
  JOURNAL   Submitted (02-JUN-2010) Crop Science, Universiti Putra Malaysia,
            Serdang, Selangor 43400, Malaysia
FEATURES             Location/Qualifiers
     source          1..962
                     /organism="Zingiber officinale"
                     /organelle="plastid:chloroplast"
                     /mol_type="genomic DNA"
                     /db_xref="taxon:94328"
                     /clone="Padi"
                     /country="Malaysia"
                     /PCR_primers="fwd_name: tRNc, fwd_seq:
                     cgaaatcggtagacgctacg, rev_name: tRNf, rev_seq:
                     atttgaactggtgacacgag"
                     /note="authority: Zingiber officinale Rosc."
     misc_feature    <1..>962
                     /note="contains tRNA-Leu (trnL), trnL-trnF intergenic
                     spacer and tRNA-Phe (trnF)"
BASE COUNT          344 a          176 c          151 g          290 t
ORIGIN      
        1 gagngcgaga cgacgcgtgc cggtaggctg ctcagtggta acttccaaat tcagaagaaa
       61 ccctggaatt taaaatgggc aatcctgagc caaatcctta gttttatcaa actagaataa
      121 aaaaaaggat aggtgcagag actcaatgga agctgttcta acgaatgaag ttgactacgt
      181 ttcgttggta gttggaatcc gtctatcaaa attacagaaa agatgttcct atatacctaa
      241 tacatacgta tacatactga catatcaaat caaacgatta atcatgactc gaatccatta
      301 tattatatga ataattataa tatgaaaaat tcagaattag agttattgtg aatccagtcc
      361 aatggaagtt gaaagaagaa ttgaatattc aattcaatta ttaaatcatt cattccagag
      421 tttgatagat cttttgaaaa actgattaat tggacgagaa taaagagaga gtcccattct
      481 acatgtcaat accgataaca atgaaattta tagtaagagg aaaatccgtc gactttagaa
      541 atcgtgaggg ttcaagtccc tctatcccca ataaaaaggt aattttactt cctaaatatt
      601 tatcctcctt tttttcatca gcgattcagt tcaaacaaaa ttcactatct ttctcattca
      661 ctccactctt tcacaacaca aatgtatccg aactaaaatt cttggatctt atcccaattt
      721 tgatagatac aatacctcta caaataaaca tatatgggca aataatctct attattgaat
      781 cattcacaca cagtccatat cattatcctt acgcttacta gttaaatttt ttactacttt
      841 ttagtccctt taattgacat agacacaaac actacaccag gatgatgcat gggaaatggt
      901 cgggatagct cagttggtag agcagaggac tgaaaatcct cgtgtcacag gtttcaaata
      961 aa
//