LOCUS       HM567394                 946 bp    DNA     linear   PLN 14-OCT-2010
DEFINITION  Zingiber officinale clone Bentong tRNA-Leu (trnL) gene, partial
            sequence; trnL-trnF intergenic spacer, complete sequence; and
            tRNA-Phe (trnF) gene, partial sequence; chloroplast.
ACCESSION   HM567394
VERSION     HM567394.1
KEYWORDS    .
SOURCE      chloroplast Zingiber officinale
  ORGANISM  Zingiber officinale
            Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
            Spermatophyta; Magnoliophyta; Liliopsida; Zingiberales;
            Zingiberaceae; Zingiber.
REFERENCE   1  (bases 1 to 946)
  AUTHORS   Valdiani,A.R., Sagineedu,S.R. and Pichika,M.R.
  TITLE     Phylogenetic Analysis and Classification of Malaysian Ginger
            (Zingiber officinale Rosc.)
  JOURNAL   Unpublished
REFERENCE   2  (bases 1 to 946)
  AUTHORS   Valdiani,A.R., Sagineedu,S.R. and Pichika,M.R.
  TITLE     Direct Submission
  JOURNAL   Submitted (02-JUN-2010) Crop Science, Universiti Putra Malaysia,
            Serdang, Selangor 43400, Malaysia
FEATURES             Location/Qualifiers
     source          1..946
                     /organism="Zingiber officinale"
                     /organelle="plastid:chloroplast"
                     /mol_type="genomic DNA"
                     /db_xref="taxon:94328"
                     /clone="Bentong"
                     /country="Malaysia"
                     /PCR_primers="fwd_name: tRNc, fwd_seq:
                     cgaaatcggtagacgctacg, rev_name: tRNf, rev_seq:
                     atttgaactggtgacacgag"
                     /note="authority: Zingiber officinale Rosc."
     misc_feature    <1..>946
                     /note="contains tRNA-Leu (trnL), trnL-trnF intergenic
                     spacer and tRNA-Phe (trnF)"
BASE COUNT          339 a          173 c          147 g          286 t
ORIGIN      
        1 gngtgcgggc cgcctaaaag agaactgcta gtggtaactt ccaaattcag agaaaccctg
       61 gaatttaaaa tgggcaatcc tgagccaaat ccttagtttt atcaaactag aataaaaaaa
      121 aggataggtg cagagactca atggaagctg ttctaacgaa tgaagttgac tacgtttcgt
      181 tggtagttgg aatccgtcta tcaaaattac agaaaagatg ttcctatata cctaatacat
      241 acgtatacat actgacatat caaatcaaac gattaatcat gactcgaatc cattatatta
      301 tatgaataat tataatatga aaaattcaga attagagtta ttgtgaatcc agtccaatgg
      361 aagttgaaag aagaattgaa tattcaattc aattattaaa tcattcattc cagagtttga
      421 tagatctttt gaaaaactga ttaattggac gagaataaag agagagtccc attctacatg
      481 tcaataccga taacaatgaa atttatagta agaggaaaat ccgtcgactt tagaaatcgt
      541 gagggttcaa gtccctctat ccccaataaa aaggtaattt tacttcctaa atatttatcc
      601 tccttttttt catcagcgat tcagttcaaa caaaattcac tatctttctc attcactcca
      661 ctctttcaca acacaaatgt atccgaacta aaattcttgg atcttatccc aattttgata
      721 gatacaatac ctctacaaat aaacatatat gggcaaataa tctctattat tgaatcattc
      781 acacacagtc catatcatta tccttacgct tactagttaa attttttact actttttagt
      841 ccctttaatt gacatagaca caaacactac accaggatga tgcatgggaa atggtcggga
      901 tagctcagtt ggtagagcag aggactgaaa atcctcgtgt cacagg
//