LOCUS       EU016553                 242 bp    mRNA    linear   HUM 01-DEC-2007
DEFINITION  Homo sapiens mutant mothers against decapentaplegic 3 (SMAD3) mRNA,
            partial sequence; alternatively spliced.
ACCESSION   EU016553
VERSION     EU016553.1
KEYWORDS    .
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 242)
  AUTHORS   Jinesh,G.G. and Karunagaran,D.
  TITLE     Homo sapiens mothers against decapentapelagic homolog 3 [Smad3]
            mRNA, splicing error mutant in SiHa cell line, exon 3 to 6
  JOURNAL   Unpublished
REFERENCE   2  (bases 1 to 242)
  AUTHORS   Jinesh,G.G. and Karunagaran,D.
  TITLE     Direct Submission
  JOURNAL   Submitted (05-JUL-2007) Division of Cancer Biology, Rajiv Gandhi
            Centre for Biotechnology, Thycaud Post, Jagathy,
            Thiruvananthapuram, Kerala 695014, India
FEATURES             Location/Qualifiers
     source          1..242
                     /db_xref="H-InvDB:HIT000484271"
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="15"
                     /map="15q23"
                     /cell_line="SiHa"
                     /PCR_primers="fwd_seq: cgagttccccccactgga, rev_seq:
                     tgcagctcaatccagcaggg"
     gene            <1..>242
                     /gene="SMAD3"
                     /note="mutant mothers against decapentaplegic 3;
                     alternatively spliced; exon 3 to 6"
     exon            <1..42
                     /gene="SMAD3"
                     /number=3
     exon            43..111
                     /gene="SMAD3"
                     /number=4
     misc_feature    112..117
                     /gene="SMAD3"
                     /note="alternatively spliced; if 'w' is an 'a' becomes end
                     of exon 4, if 'w' is a 't' becomes end of intron 4"
     exon            118..168
                     /gene="SMAD3"
                     /number=5
     variation       148
                     /gene="SMAD3"
                     /replace=""
     variation       160^161
                     /gene="SMAD3"
                     /replace="a"
     exon            169..>242
                     /gene="SMAD3"
                     /number=6
     variation       181..182
                     /gene="SMAD3"
                     /replace="t"
     variation       193
                     /gene="SMAD3"
                     /replace=""
     variation       230
                     /gene="SMAD3"
                     /replace=""
     variation       242
                     /gene="SMAD3"
                     /replace="c"
BASE COUNT           61 a           86 c           51 g           43 t
ORIGIN      
        1 ctaacttccc cgcaggcatc gagccccaga gcaatattcc agagacccca ccccctggct
       61 acctgagtga agatggagaa accagtgacc accagatgaa ccacagcatg gwcgcaggtt
      121 ctccaaacct atccccgaat ccgatgtgcc ccagcacata taacttggac ctgcagccag
      181 cctacctact gctgagccgg ccttctggtg ctccatctcc tactacgaga ctgaaccagc
      241 gt
//