LOCUS EU016553 242 bp mRNA linear HUM 01-DEC-2007 DEFINITION Homo sapiens mutant mothers against decapentaplegic 3 (SMAD3) mRNA, partial sequence; alternatively spliced. ACCESSION EU016553 VERSION EU016553.1 KEYWORDS . SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 242) AUTHORS Jinesh,G.G. and Karunagaran,D. TITLE Homo sapiens mothers against decapentapelagic homolog 3 [Smad3] mRNA, splicing error mutant in SiHa cell line, exon 3 to 6 JOURNAL Unpublished REFERENCE 2 (bases 1 to 242) AUTHORS Jinesh,G.G. and Karunagaran,D. TITLE Direct Submission JOURNAL Submitted (05-JUL-2007) Division of Cancer Biology, Rajiv Gandhi Centre for Biotechnology, Thycaud Post, Jagathy, Thiruvananthapuram, Kerala 695014, India FEATURES Location/Qualifiers source 1..242 /db_xref="H-InvDB:HIT000484271" /organism="Homo sapiens" /mol_type="mRNA" /db_xref="taxon:9606" /chromosome="15" /map="15q23" /cell_line="SiHa" /PCR_primers="fwd_seq: cgagttccccccactgga, rev_seq: tgcagctcaatccagcaggg" gene <1..>242 /gene="SMAD3" /note="mutant mothers against decapentaplegic 3; alternatively spliced; exon 3 to 6" exon <1..42 /gene="SMAD3" /number=3 exon 43..111 /gene="SMAD3" /number=4 misc_feature 112..117 /gene="SMAD3" /note="alternatively spliced; if 'w' is an 'a' becomes end of exon 4, if 'w' is a 't' becomes end of intron 4" exon 118..168 /gene="SMAD3" /number=5 variation 148 /gene="SMAD3" /replace="" variation 160^161 /gene="SMAD3" /replace="a" exon 169..>242 /gene="SMAD3" /number=6 variation 181..182 /gene="SMAD3" /replace="t" variation 193 /gene="SMAD3" /replace="" variation 230 /gene="SMAD3" /replace="" variation 242 /gene="SMAD3" /replace="c" BASE COUNT 61 a 86 c 51 g 43 t ORIGIN 1 ctaacttccc cgcaggcatc gagccccaga gcaatattcc agagacccca ccccctggct 61 acctgagtga agatggagaa accagtgacc accagatgaa ccacagcatg gwcgcaggtt 121 ctccaaacct atccccgaat ccgatgtgcc ccagcacata taacttggac ctgcagccag 181 cctacctact gctgagccgg ccttctggtg ctccatctcc tactacgaga ctgaaccagc 241 gt //