LOCUS       KJ129602                 144 bp    DNA     linear   BCT 01-OCT-2014
DEFINITION  Klebsiella pneumoniae subsp. pneumoniae isolate KP4707 mutated MgrB
            (mgrB) gene, complete cds.
ACCESSION   KJ129602
VERSION     KJ129602.1
KEYWORDS    .
SOURCE      Klebsiella pneumoniae subsp. pneumoniae
  ORGANISM  Klebsiella pneumoniae subsp. pneumoniae
            Bacteria; Pseudomonadota; Gammaproteobacteria; Enterobacterales;
            Enterobacteriaceae; Klebsiella/Raoultella group; Klebsiella.
REFERENCE   1  (bases 1 to 144)
  AUTHORS   Cannatelli,A., D'Andrea,M.M., Giani,T., Di Pilato,V., Arena,F.,
            Ambretti,S., Gaibani,P. and Rossolini,G.M.
  TITLE     In vivo emergence of colistin resistance in Klebsiella pneumoniae
            producing KPC-type carbapenemases mediated by insertional
            inactivation of the PhoQ/PhoP mgrB regulator
  JOURNAL   Antimicrob. Agents Chemother. 57 (11), 5521-5526 (2013)
   PUBMED   23979739
REFERENCE   2  (bases 1 to 144)
  AUTHORS   Cannatelli,A., Giani,T., D'Andrea,M.M., Di Pilato,V., Arena,F.,
            Conte,V., Tryfinopoulou,K., Vatopoulos,A. and Rossolini,G.M.
  CONSRTM   COLGRIT Study Group
  TITLE     MgrB Inactivation Is a Common Mechanism of Colistin Resistance in
            KPC-Producing Klebsiella pneumoniae of Clinical Origin
  JOURNAL   Antimicrob. Agents Chemother. 58 (10), 5696-5703 (2014)
   PUBMED   25022583
REFERENCE   3  (bases 1 to 144)
  AUTHORS   D'Andrea,M.M.
  TITLE     Direct Submission
  JOURNAL   Submitted (07-JAN-2014) Medical Biotechnologies, University of
            Siena, V.le Bracci, 2, Siena 53100, Italy
FEATURES             Location/Qualifiers
     source          1..144
                     /organism="Klebsiella pneumoniae subsp. pneumoniae"
                     /mol_type="genomic DNA"
                     /isolate="KP4707"
                     /isolation_source="blood"
                     /host="Homo sapiens"
                     /sub_species="pneumoniae"
                     /specimen_voucher="UNISI_KP4707"
                     /db_xref="taxon:72407"
                     /geo_loc_name="Greece: Athens"
                     /lat_lon="37.98 N 23.73 E"
                     /collection_date="2012"
                     /PCR_primers="fwd_name: mgrB_ext_F, fwd_seq:
                     aaggcgttcattctaccacc, rev_name: mgrB_ext_R, rev_seq:
                     ttaagaaggccgtgctatcc"
     gene            1..144
                     /gene="mgrB"
     CDS             1..144
                     /gene="mgrB"
                     /note="mutation g83a (C28Y)"
                     /codon_start=1
                     /transl_table=11
                     /product="mutated MgrB"
                     /protein_id="AIG22010.1"
                     /translation="MKKLRWVLLIVIIAGCLLLWTQMLNVMYDQDVQFFSGICTINKF
                     IPW"
BASE COUNT           38 a           24 c           34 g           48 t
ORIGIN      
        1 gtgaaaaaat tacggtgggt tttactgata gtcatcatag caggctgcct gttgctgtgg
       61 actcagatgc ttaacgtaat gtacgaccag gatgttcagt ttttcagcgg catttgcact
      121 attaataaat ttattccgtg gtaa
//