LOCUS JQ346088 159 bp mRNA linear HUM 11-MAR-2014 DEFINITION Homo sapiens epidermal growth factor precursor (EGF) mRNA, partial cds. ACCESSION JQ346088 VERSION JQ346088.1 KEYWORDS . SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 159) AUTHORS Khan,M.A., Khan,F., Ahmad,N., Khan,M.I., Zafar,A.U. and Husnain,T. TITLE Expression line approach to recombinant human epidermal growth factor into the yeast, Pichia pastoris from Huh-7 cell line JOURNAL Mol. Biol. Rep. 41 (3), 1445-1451 (2014) PUBMED 24413989 REFERENCE 2 (bases 1 to 159) AUTHORS Khan,M.A., Khan,F. and Khan,M.I. TITLE Direct Submission JOURNAL Submitted (02-JAN-2012) Biopharmaceutical Lab, CEMB, University of the Punjab, 87-West Canal Canal Road, Lahore, Punjab 54000, Pakistan FEATURES Location/Qualifiers source 1..159 /db_xref="H-InvDB:HIT000721382" /organism="Homo sapiens" /mol_type="mRNA" /db_xref="taxon:9606" /chromosome="4" /map="4q25-q27" /cell_line="Huh-7" /cell_type="hepato carcinoma" /PCR_primers="fwd_name: se1, fwd_seq: tcacctcagggaagatgacc, rev_name: se2, rev_seq: atcccatcctcagtgtcagc" /PCR_primers="fwd_seq: cagggaagatgaccaccact, rev_seq: tgcgactcctcacatctctg" /PCR_primers="fwd_seq: aagaattcaatagtgactctgaa, rev_seq: gcgcggccgcgcgcagttcccacca" gene <1..>159 /gene="EGF" /note="hEGF" CDS <1..>159 /gene="EGF" /codon_start=1 /product="epidermal growth factor precursor" /protein_id="AFA26280.1" /translation="NSDSECPLSHDGYCLHDGVCMYIEALDKYACNCVVGYIGERCQY RDLKWWELR" mat_peptide 1..159 /gene="EGF" /product="epidermal growth factor" BASE COUNT 36 a 33 c 48 g 42 t ORIGIN 1 aatagtgact ctgaatgtcc cctgtcccac gatgggtact gcctccatga tggtgtgtgc 61 atgtatattg aagcattgga caagtatgca tgcaactgtg ttgttggcta catcggggag 121 cgatgtcagt accgagacct gaagtggtgg gaactgcgc //