LOCUS       HG002935                 376 bp    DNA     linear   PLN 30-SEP-2013
DEFINITION  Phellodendron amurense chloroplast DNA containing trnL-trnF IGS and
            partial trnF gene, specimen voucher US:Miller 10646.
ACCESSION   HG002935
VERSION     HG002935.1
KEYWORDS    .
SOURCE      chloroplast Phellodendron amurense
  ORGANISM  Phellodendron amurense
            Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
            Spermatophyta; Magnoliopsida; eudicotyledons; Gunneridae;
            Pentapetalae; rosids; malvids; Sapindales; Rutaceae; Amyridoideae;
            Phellodendron.
REFERENCE   1  (bases 1 to 376)
  AUTHORS   Appelhans M.
  JOURNAL   Submitted (03-MAY-2013) to the INSDC. Systematic Botany, University
            of Goettingen, Untere Karspuele 2, 37073 Goettingen, GERMANY.
REFERENCE   2
  AUTHORS   Appelhans M.S., Wen J., Wood K.J., Allan G.J., Zimmer E.A.,
            Wagner W.L.
  TITLE     Molecular phylogenetic analysis of Hawaiian Rutaceae (Melicope,
            Platydesma and Zanthoxylum) and their different colonisation
            patterns
  JOURNAL   Unpublished.
FEATURES             Location/Qualifiers
     source          1..376
                     /organism="Phellodendron amurense"
                     /organelle="plastid:chloroplast"
                     /mol_type="genomic DNA"
                     /specimen_voucher="US:Miller 10646"
                     /PCR_primers="fwd_name: E, fwd_seq: ggttcaagtccctctatccc,
                     rev_name: F, rev_seq: atttgaactggtgacacgag"
                     /db_xref="taxon:68554"
     misc_feature    <1..>376
                     /note="contains trnL-trnF intergenic spacer and partial
                     trnF gene"
BASE COUNT          105 a           82 c           54 g          135 t
ORIGIN      
        1 cccccaaaaa ggcccattga ctccctaacc ctttctccta ccctctcctt ttttttgtta
       61 gtggttcaaa attcggtagg tttctcatct atcctactct tttccatttc caaaaggatc
      121 tgggcatcat tttttttttc tcttatcaca agttgtgtgg tatatacgat aggcgtagaa
      181 atgaacatct ttgagcaaag aatccccatt tgaatgattc ccaatccata ttattgctca
      241 tactgaaatt tacaaagtat tctttgtgaa gattcaagaa aagaaattcc cctcccaaga
      301 cctttaatac ttttttcttt tttaattgac ataaacccaa gtcatctagt aagatgagga
      361 tgttgtgtcg gaaatg
//