LOCUS HG002935 376 bp DNA linear PLN 30-SEP-2013 DEFINITION Phellodendron amurense chloroplast DNA containing trnL-trnF IGS and partial trnF gene, specimen voucher US:Miller 10646. ACCESSION HG002935 VERSION HG002935.1 KEYWORDS . SOURCE chloroplast Phellodendron amurense ORGANISM Phellodendron amurense Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliopsida; eudicotyledons; Gunneridae; Pentapetalae; rosids; malvids; Sapindales; Rutaceae; Amyridoideae; Phellodendron. REFERENCE 1 (bases 1 to 376) AUTHORS Appelhans M. JOURNAL Submitted (03-MAY-2013) to the INSDC. Systematic Botany, University of Goettingen, Untere Karspuele 2, 37073 Goettingen, GERMANY. REFERENCE 2 AUTHORS Appelhans M.S., Wen J., Wood K.J., Allan G.J., Zimmer E.A., Wagner W.L. TITLE Molecular phylogenetic analysis of Hawaiian Rutaceae (Melicope, Platydesma and Zanthoxylum) and their different colonisation patterns JOURNAL Unpublished. FEATURES Location/Qualifiers source 1..376 /organism="Phellodendron amurense" /organelle="plastid:chloroplast" /mol_type="genomic DNA" /specimen_voucher="US:Miller 10646" /PCR_primers="fwd_name: E, fwd_seq: ggttcaagtccctctatccc, rev_name: F, rev_seq: atttgaactggtgacacgag" /db_xref="taxon:68554" misc_feature <1..>376 /note="contains trnL-trnF intergenic spacer and partial trnF gene" BASE COUNT 105 a 82 c 54 g 135 t ORIGIN 1 cccccaaaaa ggcccattga ctccctaacc ctttctccta ccctctcctt ttttttgtta 61 gtggttcaaa attcggtagg tttctcatct atcctactct tttccatttc caaaaggatc 121 tgggcatcat tttttttttc tcttatcaca agttgtgtgg tatatacgat aggcgtagaa 181 atgaacatct ttgagcaaag aatccccatt tgaatgattc ccaatccata ttattgctca 241 tactgaaatt tacaaagtat tctttgtgaa gattcaagaa aagaaattcc cctcccaaga 301 cctttaatac ttttttcttt tttaattgac ataaacccaa gtcatctagt aagatgagga 361 tgttgtgtcg gaaatg //