LOCUS HUMB100 44 bp mRNA linear HUM 22-JAN-2005 DEFINITION Homo sapiens mRNA for basigin, 5'UTR region. ACCESSION D28441 VERSION D28441.1 KEYWORDS . SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 44) AUTHORS Kato,S. TITLE Direct Submission JOURNAL Submitted (03-FEB-1994) to the DDBJ/EMBL/GenBank databases. Contact:Seishi Kato Research Institute of National Rehabilitation Center for the Disabled, Department of Rehabilitation Engineering; 4-1 Namiki, Tokorozawa, Saitama 359-8555, Japan REFERENCE 2 AUTHORS Kato,S., Sekine,S., Oh,S., Kim,N., Umezawa,Y., Abe,N., Yokoyama-Kobayashi,M. and Aoki,T. TITLE Construction of a human full-length cDNA bank JOURNAL Gene 150, 243-250 (1994) COMMENT FEATURES Location/Qualifiers source 1..44 /cell_line="HT-1080" /clone="HP00433" /clone_lib="HT-1080/pKA1" /db_xref="H-InvDB:HIT000101270" /db_xref="taxon:9606" /mol_type="mRNA" /organism="Homo sapiens" /tissue_type="fibrosarcoma" 5'UTR 1..38 variation 1..3 /replace="atagcagccgcgggcggcggcggcagcg" variation 1..3 /replace="g" CDS 39..>44 /codon_start=1 /product="basigin" /protein_id="BAA05807.1" /translation="MA" BASE COUNT 10 a 6 c 20 g 8 t ORIGIN 1 gcggttggag gttgtaggac cggcgaggaa taggaatcat ggcg //