LOCUS AB469166 220 bp DNA linear PLN 02-APR-2009 DEFINITION Prunus mume chloroplast DNA, rpL16 intron, specimen_voucher: THS:75643. ACCESSION AB469166 VERSION AB469166.1 KEYWORDS . SOURCE chloroplast Prunus mume (Japanese apricot) ORGANISM Prunus mume Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliopsida; eudicotyledons; Gunneridae; Pentapetalae; rosids; fabids; Rosales; Rosaceae; Amygdaloideae; Amygdaleae; Prunus. REFERENCE 1 (bases 1 to 220) AUTHORS Yamaji,H., Kondo,K., Miki,E., Iketani,H., Yamaguchi,M. and Takeda,O. TITLE Direct Submission JOURNAL Submitted (30-OCT-2008) to the DDBJ/EMBL/GenBank databases. Contact:Hiroki Yamaji Tsumura & Co., Botanical Raw Material Research Dept.; 3586 Yoshiwara, Inashiki, Ami-machi, Ibaraki 300-1192, Japan REFERENCE 2 AUTHORS Yamaji,H., Kondo,K., Miki,E., Iketani,H., Yamaguchi,M. and Takeda,O. TITLE Discrimination of Xingren derived from Prunus sect. Armeniaca (Rosaceae)species by the partial rpl16 intron sequences of cpDNA, and the botanical origin of Xingrens in markets in Japan JOURNAL Unpublished (2009) COMMENT FEATURES Location/Qualifiers source 1..220 /collected_by="Noriko Yamaji" /collection_date="2004-07-07" /country="Japan:Yamanashi" /db_xref="taxon:102107" /identified_by="Hiroki Yamaji" /mol_type="genomic DNA" /organelle="plastid:chloroplast" /organism="Prunus mume" /PCR_primers="fwd_name: rpl16/F, fwd_seq: GTTTCTTCTCATCCAGCTCC, rev_name: rpl16/R, rev_seq: GAAAGAGTCAATATTCGCCC" /specimen_voucher="THS:75643" intron <1..>220 /note="rpl16 intron" BASE COUNT 72 a 23 c 21 g 104 t ORIGIN 1 tacacggtga ataatatacg gaatcgtggt attcttttaa attttatcta atctatatct 61 atatctatta taaatttaaa attttttgtg ttttaatata taattaaaca tgtcttctat 121 ttatagataa tgtcgttttt atataacgtt atcgttataa tgaatcttta ttttcttttt 181 cctttgtatt atcatatcga atcgactaaa atttagaaat //