LOCUS R03093 400 bp mRNA linear EST 31-MAR-1995 DEFINITION pk03g04.s2 Kuwabara Mixed stage C. briggsae Caenorhabditis briggsae cDNA similar to SP:SRCH_RABIT P16230 SARCOPLASMIC RETICULUM HISTIDINE-RICH CALCIUM-BINDING PROTEIN PRECURSOR, mRNA sequence. ACCESSION R03093 VERSION R03093.1 DBLINK BioSample: SAMN00154883 KEYWORDS EST. SOURCE Caenorhabditis briggsae ORGANISM Caenorhabditis briggsae Eukaryota; Metazoa; Ecdysozoa; Nematoda; Chromadorea; Rhabditida; Rhabditina; Rhabditomorpha; Rhabditoidea; Rhabditidae; Peloderinae; Caenorhabditis. REFERENCE 1 (bases 1 to 400) AUTHORS Hillier,L., Chiapelli,B., Chissoe,S., Clark,N., Couch,J., Dubuque,T., Hawkins,M., Holman,M., Hultman,M., Kucaba,T., Kuwabara,P., Le,M., Mardis,E., Marra,M., Parsons,J., Rifkin,L., Rohlfing,T., Tan,F., Trevaskis,E., Waterston,R., Wohldmann,P. and Wilson,R. TITLE Washington University Caenorhabditis briggsae EST project JOURNAL Unpublished COMMENT Other_ESTs: pk03g04.r1 Contact: Marra MA Washington University Genome Sequencing Center Washington University School of Medicine 4444 Forest Park Parkway, Box 8501, St. Louis, MO 63108 Tel: 314 286 1455 Fax: 314 286 1810 Email: mmarra@watson.wustl.edu PCR_F: TGTAAAACGACGGCCAGTGAGCAAGTTCAGCCTGG PCR_B: CAGGAAACAGCTATGACCCTTATGAGTATTTCTTCCAGGGTA Source: Washington University Genome Sequencing Center PCR amplified DNA is available from Washington University Genome Sequencing Center. Aliquots of the library may be requested from P. Kuwabara (pek@mrc-lmb.cam.ac.uk). Seq primer: Commercially available -21M13 dye primer. FEATURES Location/Qualifiers source 1..400 /organism="Caenorhabditis briggsae" /mol_type="mRNA" /strain="G16 Gujarat" /db_xref="taxon:6238" /clone_lib="SAMN00154883 Kuwabara Mixed stage C. briggsae" /note="Vector: Lambda gt10; Site_1: EcoRI; Site_2: EcoRI; Stage:mixed, Sex:hermaphrodite. Library construction: First strand oligo(dT) primed. Second strand was as per Gubler/Hoffman. Ligated to EcoRI adaptors. Library is non-directional. Library is non-normalized. Library constructed by P.E. Kuwabara. Additional details on construction of the library are described in P.E. Kuwabara and S. Shah, NAR 22: 4414 - 4418 (1994). Adaptor sequence: GAATTC CGTTGCTGTCG" BASE COUNT 77 a 103 c 76 g 142 t ORIGIN 1 ntacaatcaa agtgcgaata gaaattgggg tgtagggggt aattagtgtc taattaatga 61 gcaattatcc aaagtgcaat tagagagaag caaaaagttc ccgttgcgcg gtgaaggctg 121 atggaaccat tgtcctcacc gtcatctcca ttatcgtcgt cgtcttcatc tgaatccttc 181 tttttccggt tttccttttt catcgtcttc ttttttggct tttcttcttc ctcttcctca 241 tcgttgtcat cagacttgcc acgtcgagga tgtcgggacg tcttcttttc ggaacgtctc 301 cttcttccat cggatcaaac tcctcctcct cctcttcttc atccttctca tatctcgacg 361 gacgacctct tctagatgtt gggcttcttc ttcttacgng //