LOCUS       LN997443                 271 bp    DNA     linear   HUM 04-JAN-2016
DEFINITION  Homo sapiens MLH1 gene for MutL protein homolog 1, specimen voucher
            MCML8-13.
ACCESSION   LN997443
VERSION     LN997443.1
KEYWORDS    .
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 271)
  AUTHORS   Nachimuthu S.
  JOURNAL   Submitted (03-DEC-2015) to the INSDC. Department of Biotechnology,
            Mizoram University, Aizwal, Mizoram, 796004, INDIA.
REFERENCE   2
  AUTHORS   Yadav R.P., Ghatak S., Zohimgthanga J., Pautu J.L.,
            Senthil-Kumar N.
  TITLE     Analyses of Mutation in Cell Cycle Genes Associated with Gastric
            Cancer in Mizo Population
  JOURNAL   Unpublished.
FEATURES             Location/Qualifiers
     source          1..271
                     /organism="Homo sapiens"
                     /mol_type="genomic DNA"
                     /country="India:Aizawl, Mizoram"
                     /isolation_source="Tumour tissue"
                     /specimen_voucher="MCML8-13"
                     /sex="male"
                     /tissue_type="stomach cancer, tumour tissue"
                     /PCR_primers="fwd_name: ML8-F, fwd_seq:
                     agtttgctggtggagataagg, rev_name: ML8-R, rev_seq:
                     acaagcctgtgtatttgac"
                     /db_xref="taxon:9606"
     gene            1..271
                     /gene="MLH1"
                     /product="MutL protein homolog 1"
                     /note="exon boundaries, coding region and locus partiality
                     not recorded"
BASE COUNT           75 a           51 c           49 g           96 t
ORIGIN      
        1 tctcagccat gagacaataa atccttgtgt cttctgctgt ttgtttatca gcaaggagag
       61 acagtagctg atgttaggac actacccaat gcctcaaccg tggacaatat tcgctccgtc
      121 tttggaaatg ctgttagtcg gtatgtcgat aacctatata aaaaaatctt ttacatttat
      181 tatcttggtt tatcattcca tcacattatt ttggaacctt tcaagatatt atgtgtgtta
      241 agagtttgct ttagtcaaat acacaggctt g
//