LOCUS LN997442 271 bp DNA linear HUM 04-JAN-2016 DEFINITION Homo sapiens MLH1 gene for MutL protein homolog 1, specimen voucher MCML8-12. ACCESSION LN997442 VERSION LN997442.1 KEYWORDS . SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 271) AUTHORS Nachimuthu S. JOURNAL Submitted (03-DEC-2015) to the INSDC. Department of Biotechnology, Mizoram University, Aizwal, Mizoram, 796004, INDIA. REFERENCE 2 AUTHORS Yadav R.P., Ghatak S., Zohimgthanga J., Pautu J.L., Senthil-Kumar N. TITLE Analyses of Mutation in Cell Cycle Genes Associated with Gastric Cancer in Mizo Population JOURNAL Unpublished. FEATURES Location/Qualifiers source 1..271 /organism="Homo sapiens" /mol_type="genomic DNA" /country="India:Aizawl, Mizoram" /isolation_source="Tumour tissue" /specimen_voucher="MCML8-12" /sex="male" /tissue_type="stomach cancer, tumour tissue" /PCR_primers="fwd_name: ML8-F, fwd_seq: agtttgctggtggagataagg, rev_name: ML8-R, rev_seq: acaagcctgtgtatttgac" /db_xref="taxon:9606" gene 1..271 /gene="MLH1" /product="MutL protein homolog 1" /note="exon boundaries, coding region and locus partiality not recorded" BASE COUNT 75 a 51 c 49 g 96 t ORIGIN 1 tctcagccat gagacaataa atccttgtgt cttctgctgt ttgtttatca gcaaggagag 61 acagtagctg atgttaggac actacccaat gcctcaaccg tggacaatat tcgctccgtc 121 tttggaaatg ctgttagtcg gtatgtcgat aacctatata aaaaaatctt ttacatttat 181 tatcttggtt tatcattcca tcacattatt ttggaacctt tcaagatatt atgtgtgtta 241 agagtttgct ttagtcaaat acacaggctt g //