LOCUS       LN997432                 278 bp    DNA     linear   HUM 04-JAN-2016
DEFINITION  Homo sapiens MLH1 gene for MutL protein homolog 1, specimen voucher
            MCML8-2.
ACCESSION   LN997432
VERSION     LN997432.1
KEYWORDS    .
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 278)
  AUTHORS   Nachimuthu S.
  JOURNAL   Submitted (03-DEC-2015) to the INSDC. Department of Biotechnology,
            Mizoram University, Aizwal, Mizoram, 796004, INDIA.
REFERENCE   2
  AUTHORS   Yadav R.P., Ghatak S., Zohimgthanga J., Pautu J.L.,
            Senthil-Kumar N.
  TITLE     Analyses of Mutation in Cell Cycle Genes Associated with Gastric
            Cancer in Mizo Population
  JOURNAL   Unpublished.
FEATURES             Location/Qualifiers
     source          1..278
                     /organism="Homo sapiens"
                     /mol_type="genomic DNA"
                     /country="India:Aizawl, Mizoram"
                     /isolation_source="Tumour tissue"
                     /specimen_voucher="MCML8-2"
                     /sex="male"
                     /tissue_type="stomach cancer, tumour tissue"
                     /PCR_primers="fwd_name: ML8-F, fwd_seq:
                     agtttgctggtggagataagg, rev_name: ML8-R, rev_seq:
                     acaagcctgtgtatttgac"
                     /db_xref="taxon:9606"
     gene            1..278
                     /gene="MLH1"
                     /product="MutL protein homolog 1"
                     /note="exon boundaries, coding region and locus partiality
                     not recorded"
BASE COUNT           77 a           52 c           49 g          100 t
ORIGIN      
        1 tttcagtctc agccatgaga caataaatcc ttgtgtcttc tgctgtttgt ttatcagcaa
       61 ggagagacag tagctgatgt taggacacta cccaatgcct caaccgtgga caatattcgc
      121 tccatctttg gaaatgctgt tagtcggtat gtcgataacc tatataaaaa aatcttttac
      181 atttattatc ttggtttatc attccatcac attattttgg aacctttcaa gatattatgt
      241 gtgttaagag tttgctttag tcaaatacac aggcttgt
//