LOCUS LN997431 278 bp DNA linear HUM 04-JAN-2016 DEFINITION Homo sapiens MLH1 gene for MutL protein homolog 1, specimen voucher MCML8-1. ACCESSION LN997431 VERSION LN997431.1 KEYWORDS . SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 278) AUTHORS Nachimuthu S. JOURNAL Submitted (03-DEC-2015) to the INSDC. Department of Biotechnology, Mizoram University, Aizwal, Mizoram, 796004, INDIA. REFERENCE 2 AUTHORS Yadav R.P., Ghatak S., Zohimgthanga J., Pautu J.L., Senthil-Kumar N. TITLE Analyses of Mutation in Cell Cycle Genes Associated with Gastric Cancer in Mizo Population JOURNAL Unpublished. FEATURES Location/Qualifiers source 1..278 /organism="Homo sapiens" /mol_type="genomic DNA" /country="India:Aizawl, Mizoram" /isolation_source="Tumour tissue" /specimen_voucher="MCML8-1" /sex="male" /tissue_type="stomach cancer, tumour tissue" /PCR_primers="fwd_name: ML8-F, fwd_seq: agtttgctggtggagataagg, rev_name: ML8-R, rev_seq: acaagcctgtgtatttgac" /db_xref="taxon:9606" gene 1..278 /gene="MLH1" /product="MutL protein homolog 1" /note="exon boundaries, coding region and locus partiality not recorded" BASE COUNT 77 a 52 c 49 g 100 t ORIGIN 1 tttcagtctc agccatgaga caataaatcc ttgtgtcttc tgctgtttgt ttatcagcaa 61 ggagagacag tagctgatgt taggacacta cccaatgcct caaccgtgga caatattcgc 121 tccatctttg gaaatgctgt tagtcggtat gtcgataacc tatataaaaa aatcttttac 181 atttattatc ttggtttatc attccatcac attattttgg aacctttcaa gatattatgt 241 gtgttaagag tttgctttag tcaaatacac aggcttgt //