LOCUS       LC373509                1284 bp    mRNA    linear   INV 23-OCT-2018
DEFINITION  Papilio xuthus PxHCLB mRNA for histamine gated chloride channel
            subunit B, complete cds.
VERSION     LC373509.1
SOURCE      Papilio xuthus (Asian swallowtail)
  ORGANISM  Papilio xuthus
            Eukaryota; Metazoa; Ecdysozoa; Arthropoda; Hexapoda; Insecta;
            Pterygota; Neoptera; Holometabola; Lepidoptera; Glossata;
            Ditrysia; Papilionoidea; Papilionidae; Papilioninae; Papilio.
REFERENCE   1  (bases 1 to 1284)
  AUTHORS   Akashi,H. and Arikawa,K.
  TITLE     Direct Submission
  JOURNAL   Submitted (27-FEB-2018) to the DDBJ/EMBL/GenBank databases.
            Contact:Hiroshi Akashi
            The Graduate University for Advanced Studies (SOKENDAI),
            Department of Evolutionary Studies of Biosystems; Shonan Village,
            Hayama, Kanagawa 240-0193, Japan
            URL    :
  AUTHORS   Akashi,H., Chen,P.-J., Akiyama,T., Terai,Y., Wakakuwa,M.,
            Takayama,Y., Tominaga,M. and Arikawa,K.
  TITLE     Physiological responses of ionotropic histamine receptors, HCLA
            and HCLB, to neurotransmitter candidates in the visual system of
            butterfly, Papilio xuthus
  JOURNAL   J. Exp. Biol. (2018) In press
  REMARK    Publication Status: Available-Online prior to print
FEATURES             Location/Qualifiers
     source          1..1284
                     /collected_by="Kentaro Arikawa"
                     /country="Japan:Kanagawa, Hayama, Shonan Village"
                     /organism="Papilio xuthus"
                     /PCR_primers="fwd_name: PxhclB_F1, fwd_seq:
                     cttgtgtgcgcgattgtacagtgac, rev_name: PxhclB_R1, rev_seq:
     CDS             1..1284
                     /product="histamine gated chloride channel subunit B"
BASE COUNT          350 a          287 c          249 g          393 t
        1 atgattgtaa cagtgagaca atttttgttg tcaattatgt tcatgatgct gcaagataac
       61 atggaagcga gtagagtaca agcagctgtc agttttttag caaacgcatc atatcaagaa
      121 atggaaataa aatctgaatc cagtctatca ctaagagata tactaccggt gaaggcaaag
      181 tactacgaca agaatagagc tcctaaatta ctgggtcagc cgactattgt atactttcat
      241 gttaccgttc tatctctgga ttcgatcaac gaggaaagta tgacgtacgt agctgacata
      301 ttcctagcgc aatcttggcg tgaccctcga ctccgtctac cagagaacat gcacgaggag
      361 tatcgtatct tggatgtagc ctggcttaac aacatttgga ggcctgattg cttcttcaag
      421 aatgctaaga aagttacttt ccacgagatg agcataccca accattattt atggctgtac
      481 catgataaaa ctcttcttta tatgtctaag ttaaccctwg tattatcctg cgcgatgaaa
      541 tttgaatcgt atcctcacga cactcaaagc tgttctatga tgatagaaag tttatctcac
      601 acagtccatg atctggtgtt catctggaac ttaacagacc ctctggtcgt caacccggac
      661 atagagttac ctcaacttga tatatctaac aaytatacca gtgattgtac cattgaatay
      721 tctacaggta atttcacatg tctggctgtt gtattcaacc tgcgccgtcg wctgggttat
      781 catttattcc acacgtatat accctcggct ctaatcgtgg ttatgtcttg gatctctttc
      841 tggatcaaac ctgaagcgat acccgcgaga gtcaccttgg gagtcacatc gttgcttact
      901 ttggcaacgc aaaatacaca atcacaacaa agtctaccac cagtatcgta ygtcaaagct
      961 atagacgttt ggatgtcgtc ttgttctgtc ttcgtgtttc tatctctttt tgaatttgcg
     1021 gtcgtcaaca actacatggg gcctgtcgct actaaagcta tgaaaggtta ctctgacgaa
     1081 gatctgtcaa gagacctgga cgcgtttaag cacatattcc cgaattcagt tgaccctcga
     1141 gcgagtacat ctgcctcgct cccgcaatac gaaactttct gcaacgggag agagacagca
     1201 gtatacattg atcgtttctc tcgtttcttc ttccctttct ctttctttat tttaaacgtt
     1261 gtttattggt ccactttctt gtga