LOCUS JQ291246 479 bp DNA linear INV 24-APR-2012 DEFINITION Anopheles homunculus isolate RS20_33 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence. ACCESSION JQ291246 VERSION JQ291246.1 KEYWORDS . SOURCE Anopheles homunculus ORGANISM Anopheles homunculus Eukaryota; Metazoa; Ecdysozoa; Arthropoda; Hexapoda; Insecta; Pterygota; Neoptera; Endopterygota; Diptera; Nematocera; Culicoidea; Culicidae; Anophelinae; Anopheles. REFERENCE 1 (bases 1 to 479) AUTHORS da Cardoso,J.C., Bergo,E.S., Oliveira,T.M., Sant'ana,D.C., Motoki,M.T. and Sallum,M.A. TITLE New records of Anopheles homunculus in central and Serra do Mar biodiversity corridors of the Atlantic Forest, Brazil JOURNAL J. Am. Mosq. Control Assoc. 28 (1), 1-5 (2012) PUBMED 22533076 REFERENCE 2 (bases 1 to 479) AUTHORS Cardoso,J.C., Bergo,E.S., Oliveira,T.M.P., Sant'Ana,D.C., Motoki,M.T. and Sallum,M.A.M. TITLE Direct Submission JOURNAL Submitted (15-DEC-2011) Epidemiologia, Faculdade de Saude Publica, Universidade de Sao Paulo, Avenida Doutor Arnaldo 715, Sao Paulo, Sao Paulo 01246904, Brazil FEATURES Location/Qualifiers source 1..479 /organism="Anopheles homunculus" /mol_type="genomic DNA" /isolate="RS20_33" /specimen_voucher="FSP-USP:RS20_33" /db_xref="taxon:369908" /sex="male" /dev_stage="adult" /country="Brazil: Rio Grande do Sul state, Maquine" /collection_date="14-Jan-2011" /collected_by="Sallum MAM, Bergo ES" /PCR_primers="fwd_name: 5.8SF, fwd_seq: atcactcggctcgtggatcg, rev_name: 28SR, rev_seq: atgcttaaatttagggggtagtc" /note="larval and pupal exuviae, male genitilia kept as vouchers" rRNA <1..124 /product="5.8S ribosomal RNA" misc_RNA 125..470 /product="internal transcribed spacer 2" rRNA 471..>479 /product="28S ribosomal RNA" BASE COUNT 112 a 141 c 136 g 90 t ORIGIN 1 atgaagaccg cagctaaatg cgcgtcagaa tgtgaactgc aggacacatg aacaccgata 61 cgttgaacgc atattgcaca tcgcacgaca cagtgcgatg tacacatttt tgagtgccca 121 tcctcaccgc atagccaact atcgggcccg caagggctcc gatgcataat gatgcgttgc 181 ccagcctcgc ggctggtcaa tcattgaaac tgtgtgcgta ggaggggccg accggagcgt 241 gcgcgcgagg tccgctttcg cgagcgtctt ccgtcacggc tgagccacct tacgactctc 301 accaggaaaa acccccatgg tgcagatata caattcgaac gaccccacgc gttcggtggc 361 ctcagtgcgg tgacgataga gcgggaagac gccagagtat cgcttgagag cgggtccgtc 421 gcgcgcgcgt cgacggcgcg gtcccacaca catcctatag tgggcctcaa ataatgtgt //