LOCUS       JQ291245                 479 bp    DNA     linear   INV 24-APR-2012
DEFINITION  Anopheles homunculus isolate RS20_21 5.8S ribosomal RNA gene,
            partial sequence; internal transcribed spacer 2, complete sequence;
            and 28S ribosomal RNA gene, partial sequence.
ACCESSION   JQ291245
VERSION     JQ291245.1
KEYWORDS    .
SOURCE      Anopheles homunculus
  ORGANISM  Anopheles homunculus
            Eukaryota; Metazoa; Ecdysozoa; Arthropoda; Hexapoda; Insecta;
            Pterygota; Neoptera; Endopterygota; Diptera; Nematocera;
            Culicoidea; Culicidae; Anophelinae; Anopheles.
REFERENCE   1  (bases 1 to 479)
  AUTHORS   da Cardoso,J.C., Bergo,E.S., Oliveira,T.M., Sant'ana,D.C.,
            Motoki,M.T. and Sallum,M.A.
  TITLE     New records of Anopheles homunculus in central and Serra do Mar
            biodiversity corridors of the Atlantic Forest, Brazil
  JOURNAL   J. Am. Mosq. Control Assoc. 28 (1), 1-5 (2012)
   PUBMED   22533076
REFERENCE   2  (bases 1 to 479)
  AUTHORS   Cardoso,J.C., Bergo,E.S., Oliveira,T.M.P., Sant'Ana,D.C.,
            Motoki,M.T. and Sallum,M.A.M.
  TITLE     Direct Submission
  JOURNAL   Submitted (15-DEC-2011) Epidemiologia, Faculdade de Saude Publica,
            Universidade de Sao Paulo, Avenida Doutor Arnaldo 715, Sao Paulo,
            Sao Paulo 01246904, Brazil
FEATURES             Location/Qualifiers
     source          1..479
                     /organism="Anopheles homunculus"
                     /mol_type="genomic DNA"
                     /isolate="RS20_21"
                     /specimen_voucher="FSP-USP:RS20_21"
                     /db_xref="taxon:369908"
                     /sex="male"
                     /dev_stage="adult"
                     /country="Brazil: Rio Grande do Sul state, Maquine"
                     /collection_date="14-Jan-2011"
                     /collected_by="Sallum MAM, Bergo ES"
                     /PCR_primers="fwd_name: 5.8SF, fwd_seq:
                     atcactcggctcgtggatcg, rev_name: 28SR, rev_seq:
                     atgcttaaatttagggggtagtc"
                     /note="larval and pupal exuviae, male genitilia kept as
                     vouchers"
     rRNA            <1..124
                     /product="5.8S ribosomal RNA"
     misc_RNA        125..470
                     /product="internal transcribed spacer 2"
     rRNA            471..>479
                     /product="28S ribosomal RNA"
BASE COUNT          112 a          141 c          136 g           90 t
ORIGIN      
        1 atgaagaccg cagctaaatg cgcgtcagaa tgtgaactgc aggacacatg aacaccgata
       61 cgttgaacgc atattgcaca tcgcacgaca cagtgcgatg tacacatttt tgagtgccca
      121 tcctcaccgc atagccaact atcgggcccg caagggctcc gatgcataat gatgcgttgc
      181 ccagcctcgc ggctggtcaa tcattgaaac tgtgtgcgta ggaggggccg accggagcgt
      241 gcgcgcgagg tccgctttcg cgagcgtctt ccgtcacggc tgagccacct tacgactctc
      301 accaggaaaa acccccatgg tgcagatata caattcgaac gaccccacgc gttcggtggc
      361 ctcagtgcgg tgacgataga gcgggaagac gccagagtat cgcttgagag cgggtccgtc
      421 gcgcgcgcgt cgacggcgcg gtcccacaca catcctatag tgggcctcaa ataatgtgt
//