LOCUS JK034279 666 bp mRNA linear EST 07-FEB-2014 DEFINITION 197 (LHA-2011) Bellamya aeruginosa normalized cDNA library Bellamya aeruginosa cDNA 5', mRNA sequence. ACCESSION JK034279 VERSION JK034279.1 DBLINK BioSample: SAMN00622379 KEYWORDS EST. SOURCE Sinotaia aeruginosa ORGANISM Sinotaia aeruginosa Eukaryota; Metazoa; Spiralia; Lophotrochozoa; Mollusca; Gastropoda; Caenogastropoda; Architaenioglossa; Viviparoidea; Viviparidae; Sinotaia. REFERENCE 1 (bases 1 to 666) AUTHORS An,L.H. and Zheng,B.H. TITLE Construction and Characterization of Normalized cDNA Library from the Snail Bellamya aeruginosa Exposure to Copper JOURNAL Unpublished COMMENT Contact: An L.H. State Environmental Protection Key Laboratory Of Estuarine And Coastal Research Chinese Research Academy For Environment Sciences 8 Dayangfang BeiYuan Road, Chaoyang District, Beijing 100012, China Tel: +86-10-84913914 Fax: +86-10-84913914 Email: anlh@craes.org.cn PCR PRimers FORWARD: CTCGGGAAGCGCGCCATTGTGTTGGT BACKWARD: ATACGTCTCACTATAGGGCGAATTGGCC. FEATURES Location/Qualifiers source 1..666 /organism="Sinotaia aeruginosa" /mol_type="mRNA" /db_xref="taxon:2653872" /tissue_type="gonads; digestive gland; peripheral tissue" /clone_lib="SAMN00622379 Bellamya aeruginosa normalized cDNA library" /dev_stage="mature" /note="Vector: Lambda TripEx2; 1.5 microliter RNA solution (1-3 microgram of total RNA) was normalized using CDS and SMART Oligo IV primer firstly, and then the reaction solution was reversed transcription for synthesizing the first-strand using MMLV reverse transcriptase (Promega, USA). Subsequently, PCR reaction was operated and cDNA was extracted using Promegas PCR clean-up system kit (Madison, USA). And then the cDNA library was constructed using SMART cDNA Library Construction Kit. After that, 6000 random clones were sequenced by the ABI3730xl. BLAST homology searches in the nr and nt databases in GenBank were performed for each of the unigenes under Evalues of 1e-5. The unigenes were named after the homologous sequences in GenBank. The annotated unigenes were then matched to specific processes or functions using COG and GO tools." BASE COUNT 191 a 122 c 155 g 198 t ORIGIN 1 tagatgatat ttgtaacgag tgtgtgttgc gtgcgctgaa atttactacg atccatcgga 61 caagatgatg gagtacggag cgcaagaaat ttcagtgata atcgcagttg tactgattgc 121 tatttattat tggtctactt ctacgtacaa tcattggaga tctctgggag ttcctggccc 181 aaaaccagcc ccactcgtgg ggaaacacgg gcccgttttt gttccgaaag aagtcgatgg 241 tcgaaacggt agatgacttg tacagagcat tcaaagatga gccatatttt ggtttttaca 301 acgcgcggat gccagttctg atggtaacgg atcctgattt aatacgtcag atcttaataa 361 aagactttca tgtcttccct ggtcgtgggt ttagcttcca gaacgacgag cctctggtac 421 atcatctgtt taatatcgat ggacacaaat ggaaagtaat gaggtctaaa ttaactccag 481 tgtttactac gggaaaactt aaacacatga ttgacttgat gatcgagtgt gcagatcact 541 ttgaaaaata tctccagaat caagttggca aaggtaaagt tatcgagtgt cgtgaagtaa 601 cagctaaatt ttactacaga tgttattggc tcgtgtgcat ttggtatcat catgaatgca 661 cttgac //