LOCUS JK034272 799 bp mRNA linear EST 07-FEB-2014 DEFINITION 190 (LHA-2011) Bellamya aeruginosa normalized cDNA library Bellamya aeruginosa cDNA 5', mRNA sequence. ACCESSION JK034272 VERSION JK034272.1 DBLINK BioSample: SAMN00622379 KEYWORDS EST. SOURCE Sinotaia aeruginosa ORGANISM Sinotaia aeruginosa Eukaryota; Metazoa; Spiralia; Lophotrochozoa; Mollusca; Gastropoda; Caenogastropoda; Architaenioglossa; Viviparoidea; Viviparidae; Sinotaia. REFERENCE 1 (bases 1 to 799) AUTHORS An,L.H. and Zheng,B.H. TITLE Construction and Characterization of Normalized cDNA Library from the Snail Bellamya aeruginosa Exposure to Copper JOURNAL Unpublished COMMENT Contact: An L.H. State Environmental Protection Key Laboratory Of Estuarine And Coastal Research Chinese Research Academy For Environment Sciences 8 Dayangfang BeiYuan Road, Chaoyang District, Beijing 100012, China Tel: +86-10-84913914 Fax: +86-10-84913914 Email: anlh@craes.org.cn PCR PRimers FORWARD: CTCGGGAAGCGCGCCATTGTGTTGGT BACKWARD: ATACGTCTCACTATAGGGCGAATTGGCC. FEATURES Location/Qualifiers source 1..799 /organism="Sinotaia aeruginosa" /mol_type="mRNA" /db_xref="taxon:2653872" /tissue_type="gonads; digestive gland; peripheral tissue" /clone_lib="SAMN00622379 Bellamya aeruginosa normalized cDNA library" /dev_stage="mature" /note="Vector: Lambda TripEx2; 1.5 microliter RNA solution (1-3 microgram of total RNA) was normalized using CDS and SMART Oligo IV primer firstly, and then the reaction solution was reversed transcription for synthesizing the first-strand using MMLV reverse transcriptase (Promega, USA). Subsequently, PCR reaction was operated and cDNA was extracted using Promegas PCR clean-up system kit (Madison, USA). And then the cDNA library was constructed using SMART cDNA Library Construction Kit. After that, 6000 random clones were sequenced by the ABI3730xl. BLAST homology searches in the nr and nt databases in GenBank were performed for each of the unigenes under Evalues of 1e-5. The unigenes were named after the homologous sequences in GenBank. The annotated unigenes were then matched to specific processes or functions using COG and GO tools." BASE COUNT 193 a 185 c 204 g 217 t ORIGIN 1 tttgtcatca agcgtgtaac cagtgaatgg ctgtgccatg tcatcgttta tcactgttgt 61 cgacgcgcta caacattggg gaaaacacag caacaaccgt cctgccttca tcttccttga 121 ccacaagggt gggcgacagg tcttcacgtg ggaaatcttg tacagcttag ctaggcgttg 181 ggctgcccat ttacataaag atgggatagg taagggccag tttgtggtta acgccctgcc 241 caacagtcct gagcgggtcg tgagtgaagc tgcggttcta ttctccgggg ctgctactgt 301 gaacggacag tgccaactgg atgatggctc ggatctcctg agcatccttc ggcagtcgcg 361 tgctaccgct cttctcataa atcctgacac ccacaaaagt gcatgggatg cgttgcaaga 421 gcatgtccac actataactg gcagcctcgt gacgtcaaag gagttaccaa acctctgtcg 481 ttcttacctt atccgtagaa cagcggatga taattttctg aaaaatttgg aatcatccat 541 gaattcgttc cttgcaaagg atgtcaaggc tggagacgtc tgcactgtat tcacaaaatc 601 aggtactagc ggaattttta agctggtcgc tttcactcat ggtgacctag ttaacatatt 661 ggcagactac aacatgctaa tagctagcaa taggtgtgct gccaaagagt tcaacatggc 721 tcctctaggg ttgatagttg gttatgccgg tcaggtgttt ctgagaggag gtatccgtgt 781 tctttgtgat gtgacacgt //