LOCUS       JK034272                 799 bp    mRNA    linear   EST 07-FEB-2014
DEFINITION  190 (LHA-2011) Bellamya aeruginosa normalized cDNA library Bellamya
            aeruginosa cDNA 5', mRNA sequence.
ACCESSION   JK034272
VERSION     JK034272.1
DBLINK      BioSample: SAMN00622379
KEYWORDS    EST.
SOURCE      Sinotaia aeruginosa
  ORGANISM  Sinotaia aeruginosa
            Eukaryota; Metazoa; Spiralia; Lophotrochozoa; Mollusca; Gastropoda;
            Caenogastropoda; Architaenioglossa; Viviparoidea; Viviparidae;
            Sinotaia.
REFERENCE   1  (bases 1 to 799)
  AUTHORS   An,L.H. and Zheng,B.H.
  TITLE     Construction and Characterization of Normalized cDNA Library from
            the Snail Bellamya aeruginosa Exposure to Copper
  JOURNAL   Unpublished
COMMENT     Contact: An L.H.
            State Environmental Protection Key Laboratory Of Estuarine And
            Coastal Research
            Chinese Research Academy For Environment Sciences
            8 Dayangfang BeiYuan Road, Chaoyang District, Beijing 100012, China
            Tel: +86-10-84913914
            Fax: +86-10-84913914
            Email: anlh@craes.org.cn
            PCR PRimers
            FORWARD: CTCGGGAAGCGCGCCATTGTGTTGGT
            BACKWARD: ATACGTCTCACTATAGGGCGAATTGGCC.
FEATURES             Location/Qualifiers
     source          1..799
                     /organism="Sinotaia aeruginosa"
                     /mol_type="mRNA"
                     /db_xref="taxon:2653872"
                     /tissue_type="gonads; digestive gland; peripheral tissue"
                     /clone_lib="SAMN00622379 Bellamya aeruginosa normalized
                     cDNA library"
                     /dev_stage="mature"
                     /note="Vector: Lambda TripEx2; 1.5 microliter RNA solution
                     (1-3 microgram of total RNA) was normalized using CDS and
                     SMART Oligo IV primer firstly, and then the reaction
                     solution was reversed transcription for synthesizing the
                     first-strand using MMLV reverse transcriptase (Promega,
                     USA). Subsequently, PCR reaction was operated and cDNA was
                     extracted using Promegas PCR clean-up system kit (Madison,
                     USA). And then the cDNA library was constructed using
                     SMART cDNA Library Construction Kit. After that, 6000
                     random clones were sequenced by the ABI3730xl. BLAST
                     homology searches in the nr and nt databases in GenBank
                     were performed for each of the unigenes under Evalues of
                     1e-5. The unigenes were named after the homologous
                     sequences in GenBank. The annotated unigenes were then
                     matched to specific processes or functions using COG and
                     GO tools."
BASE COUNT          193 a          185 c          204 g          217 t
ORIGIN      
        1 tttgtcatca agcgtgtaac cagtgaatgg ctgtgccatg tcatcgttta tcactgttgt
       61 cgacgcgcta caacattggg gaaaacacag caacaaccgt cctgccttca tcttccttga
      121 ccacaagggt gggcgacagg tcttcacgtg ggaaatcttg tacagcttag ctaggcgttg
      181 ggctgcccat ttacataaag atgggatagg taagggccag tttgtggtta acgccctgcc
      241 caacagtcct gagcgggtcg tgagtgaagc tgcggttcta ttctccgggg ctgctactgt
      301 gaacggacag tgccaactgg atgatggctc ggatctcctg agcatccttc ggcagtcgcg
      361 tgctaccgct cttctcataa atcctgacac ccacaaaagt gcatgggatg cgttgcaaga
      421 gcatgtccac actataactg gcagcctcgt gacgtcaaag gagttaccaa acctctgtcg
      481 ttcttacctt atccgtagaa cagcggatga taattttctg aaaaatttgg aatcatccat
      541 gaattcgttc cttgcaaagg atgtcaaggc tggagacgtc tgcactgtat tcacaaaatc
      601 aggtactagc ggaattttta agctggtcgc tttcactcat ggtgacctag ttaacatatt
      661 ggcagactac aacatgctaa tagctagcaa taggtgtgct gccaaagagt tcaacatggc
      721 tcctctaggg ttgatagttg gttatgccgg tcaggtgttt ctgagaggag gtatccgtgt
      781 tctttgtgat gtgacacgt
//