LOCUS       JK034265                 882 bp    mRNA    linear   EST 07-FEB-2014
DEFINITION  183 (LHA-2011) Bellamya aeruginosa normalized cDNA library Bellamya
            aeruginosa cDNA 5', mRNA sequence.
ACCESSION   JK034265
VERSION     JK034265.1
DBLINK      BioSample: SAMN00622379
KEYWORDS    EST.
SOURCE      Sinotaia aeruginosa
  ORGANISM  Sinotaia aeruginosa
            Eukaryota; Metazoa; Spiralia; Lophotrochozoa; Mollusca; Gastropoda;
            Caenogastropoda; Architaenioglossa; Viviparoidea; Viviparidae;
            Sinotaia.
REFERENCE   1  (bases 1 to 882)
  AUTHORS   An,L.H. and Zheng,B.H.
  TITLE     Construction and Characterization of Normalized cDNA Library from
            the Snail Bellamya aeruginosa Exposure to Copper
  JOURNAL   Unpublished
COMMENT     Contact: An L.H.
            State Environmental Protection Key Laboratory Of Estuarine And
            Coastal Research
            Chinese Research Academy For Environment Sciences
            8 Dayangfang BeiYuan Road, Chaoyang District, Beijing 100012, China
            Tel: +86-10-84913914
            Fax: +86-10-84913914
            Email: anlh@craes.org.cn
            PCR PRimers
            FORWARD: CTCGGGAAGCGCGCCATTGTGTTGGT
            BACKWARD: ATACGTCTCACTATAGGGCGAATTGGCC.
FEATURES             Location/Qualifiers
     source          1..882
                     /organism="Sinotaia aeruginosa"
                     /mol_type="mRNA"
                     /db_xref="taxon:2653872"
                     /tissue_type="gonads; digestive gland; peripheral tissue"
                     /clone_lib="SAMN00622379 Bellamya aeruginosa normalized
                     cDNA library"
                     /dev_stage="mature"
                     /note="Vector: Lambda TripEx2; 1.5 microliter RNA solution
                     (1-3 microgram of total RNA) was normalized using CDS and
                     SMART Oligo IV primer firstly, and then the reaction
                     solution was reversed transcription for synthesizing the
                     first-strand using MMLV reverse transcriptase (Promega,
                     USA). Subsequently, PCR reaction was operated and cDNA was
                     extracted using Promegas PCR clean-up system kit (Madison,
                     USA). And then the cDNA library was constructed using
                     SMART cDNA Library Construction Kit. After that, 6000
                     random clones were sequenced by the ABI3730xl. BLAST
                     homology searches in the nr and nt databases in GenBank
                     were performed for each of the unigenes under Evalues of
                     1e-5. The unigenes were named after the homologous
                     sequences in GenBank. The annotated unigenes were then
                     matched to specific processes or functions using COG and
                     GO tools."
BASE COUNT          230 a          173 c          208 g          271 t
ORIGIN      
        1 tcgacccgtt catagtcaag tccggtcaga ggcggcccga gagctgtgaa ccacgccttt
       61 ttccttcctg ttgttgggac cttcgttggt tcgggacttt tgttggttct ccggtttccg
      121 gtcttcctag cctccacatg aatttcggca gtgcgggtac accgacacat tgtctcgtga
      181 gaagcctgtg cagtggagcg tagagtcggg aactgagaag tttatatgca cgtaaccatc
      241 atccaaccag caacttgtag ccagcgcaag gccgggacgc cacacagcga gcgagcgtgt
      301 gcatcggacg gcgtgctagt tgacgccagg tcatgtactt tgttgacttt tctatactcc
      361 taaaaactct tgttcgatga tgagatagtc gaatttagta tgtgggacag atatcattag
      421 agtaaggggt taaaccaatt ttcggaatat tatttttcaa gtgactgttg atttaaattt
      481 gtatttgtaa aatctgtata atagttaata aatttatctt ttgttacttt tcattcttct
      541 tacgcatacc aaatttcgtt gtatgtctgg agtaatgtgg gtggatgggg gctccttaaa
      601 aaatagttga atcaaatcga attactcctt tagtaggaag ttccaccagc gaaccagtat
      661 aaattatgtg tccgatgggg gtgtaagctt atcgtgacga gtgaatggaa gtttaaaatc
      721 ttacaatttg atcactgatg agcgattatg actgttaatg aaaatagttc ttaaatttaa
      781 cagctcataa ttaaggtaca caccaggcgg cgtcacacat tgtctgtaat attctacgtg
      841 ggtccaaaac ctgagcagtt gtcgaccatc agcgaagtac tg
//