LOCUS JK034258 921 bp mRNA linear EST 07-FEB-2014 DEFINITION 176 (LHA-2011) Bellamya aeruginosa normalized cDNA library Bellamya aeruginosa cDNA 5', mRNA sequence. ACCESSION JK034258 VERSION JK034258.1 DBLINK BioSample: SAMN00622379 KEYWORDS EST. SOURCE Sinotaia aeruginosa ORGANISM Sinotaia aeruginosa Eukaryota; Metazoa; Spiralia; Lophotrochozoa; Mollusca; Gastropoda; Caenogastropoda; Architaenioglossa; Viviparoidea; Viviparidae; Sinotaia. REFERENCE 1 (bases 1 to 921) AUTHORS An,L.H. and Zheng,B.H. TITLE Construction and Characterization of Normalized cDNA Library from the Snail Bellamya aeruginosa Exposure to Copper JOURNAL Unpublished COMMENT Contact: An L.H. State Environmental Protection Key Laboratory Of Estuarine And Coastal Research Chinese Research Academy For Environment Sciences 8 Dayangfang BeiYuan Road, Chaoyang District, Beijing 100012, China Tel: +86-10-84913914 Fax: +86-10-84913914 Email: anlh@craes.org.cn PCR PRimers FORWARD: CTCGGGAAGCGCGCCATTGTGTTGGT BACKWARD: ATACGTCTCACTATAGGGCGAATTGGCC. FEATURES Location/Qualifiers source 1..921 /organism="Sinotaia aeruginosa" /mol_type="mRNA" /db_xref="taxon:2653872" /tissue_type="gonads; digestive gland; peripheral tissue" /clone_lib="SAMN00622379 Bellamya aeruginosa normalized cDNA library" /dev_stage="mature" /note="Vector: Lambda TripEx2; 1.5 microliter RNA solution (1-3 microgram of total RNA) was normalized using CDS and SMART Oligo IV primer firstly, and then the reaction solution was reversed transcription for synthesizing the first-strand using MMLV reverse transcriptase (Promega, USA). Subsequently, PCR reaction was operated and cDNA was extracted using Promegas PCR clean-up system kit (Madison, USA). And then the cDNA library was constructed using SMART cDNA Library Construction Kit. After that, 6000 random clones were sequenced by the ABI3730xl. BLAST homology searches in the nr and nt databases in GenBank were performed for each of the unigenes under Evalues of 1e-5. The unigenes were named after the homologous sequences in GenBank. The annotated unigenes were then matched to specific processes or functions using COG and GO tools." BASE COUNT 267 a 185 c 215 g 254 t ORIGIN 1 tgaacggcgt tgagggaagg gtcgtagtgt gtgtactgac aacacgtaca catagatata 61 cgtcatccgg gtttacgcag ttcacttggc cctttggatg ttgacaatac aaaggtagga 121 tatatataag ctgtgtttag atcatcgttc gactttaaaa gtatttagct attgataggc 181 cttataagag accataatat ggttataaag gttgtaaata tacaataacg cgcgatagag 241 gaatccaaga gtttacattt caataagagt tgaatgtgcc atacatattt acatagtagt 301 gaatttggtg tgggcattaa aaaaaaacaa ctcgaagacg accaactcaa cacgaagcat 361 tttcaacttc ttttttaaag atcctccagt tatttggatg acgcttccat ggcaactgta 421 gagatgactc aacagatatc aggccagaag gttctgggta tcattggtac tggagactat 481 gctagagctc tggctaaacg cctcatcttc tccgggtaca atgtcattat tggcagtcgc 541 tggccagagc gacgtcagct gtcgatgtat gatgactgcc tttgtggagt gcagatgacg 601 tcaatagaag actgtatctc acgctgtgac ataattgtag cagctatcca catggaaaac 661 tttcagaaga ctctagcacc tcatgctgat attctggcag ggaaagtagt tatcgatgta 721 tcgaacagaa caaaccgtta cagcgcaata tcgaatgccg agttcttgca atcccttata 781 ccctgtgcca tagtggtcaa ggctttcaat actgtgtctg cctacagaat ggaagaccag 841 gctagcgtgg gtaacaacag ggtctttgtg tgctctgaca accagctcgc acgtgatcgc 901 gtactgtcct tggcacgtga c //