LOCUS       JK034258                 921 bp    mRNA    linear   EST 07-FEB-2014
DEFINITION  176 (LHA-2011) Bellamya aeruginosa normalized cDNA library Bellamya
            aeruginosa cDNA 5', mRNA sequence.
ACCESSION   JK034258
VERSION     JK034258.1
DBLINK      BioSample: SAMN00622379
KEYWORDS    EST.
SOURCE      Sinotaia aeruginosa
  ORGANISM  Sinotaia aeruginosa
            Eukaryota; Metazoa; Spiralia; Lophotrochozoa; Mollusca; Gastropoda;
            Caenogastropoda; Architaenioglossa; Viviparoidea; Viviparidae;
            Sinotaia.
REFERENCE   1  (bases 1 to 921)
  AUTHORS   An,L.H. and Zheng,B.H.
  TITLE     Construction and Characterization of Normalized cDNA Library from
            the Snail Bellamya aeruginosa Exposure to Copper
  JOURNAL   Unpublished
COMMENT     Contact: An L.H.
            State Environmental Protection Key Laboratory Of Estuarine And
            Coastal Research
            Chinese Research Academy For Environment Sciences
            8 Dayangfang BeiYuan Road, Chaoyang District, Beijing 100012, China
            Tel: +86-10-84913914
            Fax: +86-10-84913914
            Email: anlh@craes.org.cn
            PCR PRimers
            FORWARD: CTCGGGAAGCGCGCCATTGTGTTGGT
            BACKWARD: ATACGTCTCACTATAGGGCGAATTGGCC.
FEATURES             Location/Qualifiers
     source          1..921
                     /organism="Sinotaia aeruginosa"
                     /mol_type="mRNA"
                     /db_xref="taxon:2653872"
                     /tissue_type="gonads; digestive gland; peripheral tissue"
                     /clone_lib="SAMN00622379 Bellamya aeruginosa normalized
                     cDNA library"
                     /dev_stage="mature"
                     /note="Vector: Lambda TripEx2; 1.5 microliter RNA solution
                     (1-3 microgram of total RNA) was normalized using CDS and
                     SMART Oligo IV primer firstly, and then the reaction
                     solution was reversed transcription for synthesizing the
                     first-strand using MMLV reverse transcriptase (Promega,
                     USA). Subsequently, PCR reaction was operated and cDNA was
                     extracted using Promegas PCR clean-up system kit (Madison,
                     USA). And then the cDNA library was constructed using
                     SMART cDNA Library Construction Kit. After that, 6000
                     random clones were sequenced by the ABI3730xl. BLAST
                     homology searches in the nr and nt databases in GenBank
                     were performed for each of the unigenes under Evalues of
                     1e-5. The unigenes were named after the homologous
                     sequences in GenBank. The annotated unigenes were then
                     matched to specific processes or functions using COG and
                     GO tools."
BASE COUNT          267 a          185 c          215 g          254 t
ORIGIN      
        1 tgaacggcgt tgagggaagg gtcgtagtgt gtgtactgac aacacgtaca catagatata
       61 cgtcatccgg gtttacgcag ttcacttggc cctttggatg ttgacaatac aaaggtagga
      121 tatatataag ctgtgtttag atcatcgttc gactttaaaa gtatttagct attgataggc
      181 cttataagag accataatat ggttataaag gttgtaaata tacaataacg cgcgatagag
      241 gaatccaaga gtttacattt caataagagt tgaatgtgcc atacatattt acatagtagt
      301 gaatttggtg tgggcattaa aaaaaaacaa ctcgaagacg accaactcaa cacgaagcat
      361 tttcaacttc ttttttaaag atcctccagt tatttggatg acgcttccat ggcaactgta
      421 gagatgactc aacagatatc aggccagaag gttctgggta tcattggtac tggagactat
      481 gctagagctc tggctaaacg cctcatcttc tccgggtaca atgtcattat tggcagtcgc
      541 tggccagagc gacgtcagct gtcgatgtat gatgactgcc tttgtggagt gcagatgacg
      601 tcaatagaag actgtatctc acgctgtgac ataattgtag cagctatcca catggaaaac
      661 tttcagaaga ctctagcacc tcatgctgat attctggcag ggaaagtagt tatcgatgta
      721 tcgaacagaa caaaccgtta cagcgcaata tcgaatgccg agttcttgca atcccttata
      781 ccctgtgcca tagtggtcaa ggctttcaat actgtgtctg cctacagaat ggaagaccag
      841 gctagcgtgg gtaacaacag ggtctttgtg tgctctgaca accagctcgc acgtgatcgc
      901 gtactgtcct tggcacgtga c
//