LOCUS       JK034251                 925 bp    mRNA    linear   EST 07-FEB-2014
DEFINITION  169 (LHA-2011) Bellamya aeruginosa normalized cDNA library Bellamya
            aeruginosa cDNA 5', mRNA sequence.
ACCESSION   JK034251
VERSION     JK034251.1
DBLINK      BioSample: SAMN00622379
KEYWORDS    EST.
SOURCE      Sinotaia aeruginosa
  ORGANISM  Sinotaia aeruginosa
            Eukaryota; Metazoa; Spiralia; Lophotrochozoa; Mollusca; Gastropoda;
            Caenogastropoda; Architaenioglossa; Viviparoidea; Viviparidae;
            Sinotaia.
REFERENCE   1  (bases 1 to 925)
  AUTHORS   An,L.H. and Zheng,B.H.
  TITLE     Construction and Characterization of Normalized cDNA Library from
            the Snail Bellamya aeruginosa Exposure to Copper
  JOURNAL   Unpublished
COMMENT     Contact: An L.H.
            State Environmental Protection Key Laboratory Of Estuarine And
            Coastal Research
            Chinese Research Academy For Environment Sciences
            8 Dayangfang BeiYuan Road, Chaoyang District, Beijing 100012, China
            Tel: +86-10-84913914
            Fax: +86-10-84913914
            Email: anlh@craes.org.cn
            PCR PRimers
            FORWARD: CTCGGGAAGCGCGCCATTGTGTTGGT
            BACKWARD: ATACGTCTCACTATAGGGCGAATTGGCC.
FEATURES             Location/Qualifiers
     source          1..925
                     /organism="Sinotaia aeruginosa"
                     /mol_type="mRNA"
                     /db_xref="taxon:2653872"
                     /tissue_type="gonads; digestive gland; peripheral tissue"
                     /clone_lib="SAMN00622379 Bellamya aeruginosa normalized
                     cDNA library"
                     /dev_stage="mature"
                     /note="Vector: Lambda TripEx2; 1.5 microliter RNA solution
                     (1-3 microgram of total RNA) was normalized using CDS and
                     SMART Oligo IV primer firstly, and then the reaction
                     solution was reversed transcription for synthesizing the
                     first-strand using MMLV reverse transcriptase (Promega,
                     USA). Subsequently, PCR reaction was operated and cDNA was
                     extracted using Promegas PCR clean-up system kit (Madison,
                     USA). And then the cDNA library was constructed using
                     SMART cDNA Library Construction Kit. After that, 6000
                     random clones were sequenced by the ABI3730xl. BLAST
                     homology searches in the nr and nt databases in GenBank
                     were performed for each of the unigenes under Evalues of
                     1e-5. The unigenes were named after the homologous
                     sequences in GenBank. The annotated unigenes were then
                     matched to specific processes or functions using COG and
                     GO tools."
BASE COUNT          250 a          244 c          211 g          220 t
ORIGIN      
        1 gcgcgtggga gctctcacac attgcactag cctgtttctt tgttctcctt aaggctcgaa
       61 cctttcacca cctaacatcc accatgagcg atctaccaga actctgggct aagctccaag
      121 gagccacaga atgcaaatct ctgcttaaaa aacatttgac tcaggaactt tacgacgaac
      181 tcaaagacaa gaaatcctcc tttaatggaa cgctggccga ctgcattcga tcaggctgtg
      241 aaaatctaga cagtggtgtt gggatctacg cctctgaccc agacgcatac acggtctttg
      301 ctccagttct ggacaatgtc atcaaggact ttcacaaagt ggacaagctt tgccacccac
      361 catccaactt tggggtggat aagatcgact ttggcgacct ggaccccagc ggtgattaca
      421 tcatttctac ccgcgttcga gtggggcgca gccacgctag ctacggattc ccccccgtgc
      481 tgaacaaaga ggaccgaatc gccatggaga aggttactct ggatgccctt aactctctgg
      541 aaggagaact gaaaggaact tactatcctt tgactggcat gagcaaggaa actcagaaac
      601 agctcacaga agaccatttt ctctttaacg acagtgacag gttcttgaag gcagctggcg
      661 gctataacga ctggcccatt ggccgtggca tcttccacac tcctgataag aagttcctcg
      721 tatgggtgaa tgaggaagac catctacgat tcatctccat gcagaaggga ggtgacctta
      781 aggaggtcta cgtgaggttg gtcaaggcca tcaaccatct tgagaagaaa cttacctttg
      841 caaagaaaga gaacttgggt tacctaacat tctgtccctc taaacttggt actactcttc
      901 gtgcgtccgt gcacatcaaa atccc
//