LOCUS JK034251 925 bp mRNA linear EST 07-FEB-2014 DEFINITION 169 (LHA-2011) Bellamya aeruginosa normalized cDNA library Bellamya aeruginosa cDNA 5', mRNA sequence. ACCESSION JK034251 VERSION JK034251.1 DBLINK BioSample: SAMN00622379 KEYWORDS EST. SOURCE Sinotaia aeruginosa ORGANISM Sinotaia aeruginosa Eukaryota; Metazoa; Spiralia; Lophotrochozoa; Mollusca; Gastropoda; Caenogastropoda; Architaenioglossa; Viviparoidea; Viviparidae; Sinotaia. REFERENCE 1 (bases 1 to 925) AUTHORS An,L.H. and Zheng,B.H. TITLE Construction and Characterization of Normalized cDNA Library from the Snail Bellamya aeruginosa Exposure to Copper JOURNAL Unpublished COMMENT Contact: An L.H. State Environmental Protection Key Laboratory Of Estuarine And Coastal Research Chinese Research Academy For Environment Sciences 8 Dayangfang BeiYuan Road, Chaoyang District, Beijing 100012, China Tel: +86-10-84913914 Fax: +86-10-84913914 Email: anlh@craes.org.cn PCR PRimers FORWARD: CTCGGGAAGCGCGCCATTGTGTTGGT BACKWARD: ATACGTCTCACTATAGGGCGAATTGGCC. FEATURES Location/Qualifiers source 1..925 /organism="Sinotaia aeruginosa" /mol_type="mRNA" /db_xref="taxon:2653872" /tissue_type="gonads; digestive gland; peripheral tissue" /clone_lib="SAMN00622379 Bellamya aeruginosa normalized cDNA library" /dev_stage="mature" /note="Vector: Lambda TripEx2; 1.5 microliter RNA solution (1-3 microgram of total RNA) was normalized using CDS and SMART Oligo IV primer firstly, and then the reaction solution was reversed transcription for synthesizing the first-strand using MMLV reverse transcriptase (Promega, USA). Subsequently, PCR reaction was operated and cDNA was extracted using Promegas PCR clean-up system kit (Madison, USA). And then the cDNA library was constructed using SMART cDNA Library Construction Kit. After that, 6000 random clones were sequenced by the ABI3730xl. BLAST homology searches in the nr and nt databases in GenBank were performed for each of the unigenes under Evalues of 1e-5. The unigenes were named after the homologous sequences in GenBank. The annotated unigenes were then matched to specific processes or functions using COG and GO tools." BASE COUNT 250 a 244 c 211 g 220 t ORIGIN 1 gcgcgtggga gctctcacac attgcactag cctgtttctt tgttctcctt aaggctcgaa 61 cctttcacca cctaacatcc accatgagcg atctaccaga actctgggct aagctccaag 121 gagccacaga atgcaaatct ctgcttaaaa aacatttgac tcaggaactt tacgacgaac 181 tcaaagacaa gaaatcctcc tttaatggaa cgctggccga ctgcattcga tcaggctgtg 241 aaaatctaga cagtggtgtt gggatctacg cctctgaccc agacgcatac acggtctttg 301 ctccagttct ggacaatgtc atcaaggact ttcacaaagt ggacaagctt tgccacccac 361 catccaactt tggggtggat aagatcgact ttggcgacct ggaccccagc ggtgattaca 421 tcatttctac ccgcgttcga gtggggcgca gccacgctag ctacggattc ccccccgtgc 481 tgaacaaaga ggaccgaatc gccatggaga aggttactct ggatgccctt aactctctgg 541 aaggagaact gaaaggaact tactatcctt tgactggcat gagcaaggaa actcagaaac 601 agctcacaga agaccatttt ctctttaacg acagtgacag gttcttgaag gcagctggcg 661 gctataacga ctggcccatt ggccgtggca tcttccacac tcctgataag aagttcctcg 721 tatgggtgaa tgaggaagac catctacgat tcatctccat gcagaaggga ggtgacctta 781 aggaggtcta cgtgaggttg gtcaaggcca tcaaccatct tgagaagaaa cttacctttg 841 caaagaaaga gaacttgggt tacctaacat tctgtccctc taaacttggt actactcttc 901 gtgcgtccgt gcacatcaaa atccc //