LOCUS       JK034237                 841 bp    mRNA    linear   EST 07-FEB-2014
DEFINITION  155 (LHA-2011) Bellamya aeruginosa normalized cDNA library Bellamya
            aeruginosa cDNA 5', mRNA sequence.
ACCESSION   JK034237
VERSION     JK034237.1
DBLINK      BioSample: SAMN00622379
KEYWORDS    EST.
SOURCE      Sinotaia aeruginosa
  ORGANISM  Sinotaia aeruginosa
            Eukaryota; Metazoa; Spiralia; Lophotrochozoa; Mollusca; Gastropoda;
            Caenogastropoda; Architaenioglossa; Viviparoidea; Viviparidae;
            Sinotaia.
REFERENCE   1  (bases 1 to 841)
  AUTHORS   An,L.H. and Zheng,B.H.
  TITLE     Construction and Characterization of Normalized cDNA Library from
            the Snail Bellamya aeruginosa Exposure to Copper
  JOURNAL   Unpublished
COMMENT     Contact: An L.H.
            State Environmental Protection Key Laboratory Of Estuarine And
            Coastal Research
            Chinese Research Academy For Environment Sciences
            8 Dayangfang BeiYuan Road, Chaoyang District, Beijing 100012, China
            Tel: +86-10-84913914
            Fax: +86-10-84913914
            Email: anlh@craes.org.cn
            PCR PRimers
            FORWARD: CTCGGGAAGCGCGCCATTGTGTTGGT
            BACKWARD: ATACGTCTCACTATAGGGCGAATTGGCC.
FEATURES             Location/Qualifiers
     source          1..841
                     /organism="Sinotaia aeruginosa"
                     /mol_type="mRNA"
                     /db_xref="taxon:2653872"
                     /tissue_type="gonads; digestive gland; peripheral tissue"
                     /clone_lib="SAMN00622379 Bellamya aeruginosa normalized
                     cDNA library"
                     /dev_stage="mature"
                     /note="Vector: Lambda TripEx2; 1.5 microliter RNA solution
                     (1-3 microgram of total RNA) was normalized using CDS and
                     SMART Oligo IV primer firstly, and then the reaction
                     solution was reversed transcription for synthesizing the
                     first-strand using MMLV reverse transcriptase (Promega,
                     USA). Subsequently, PCR reaction was operated and cDNA was
                     extracted using Promegas PCR clean-up system kit (Madison,
                     USA). And then the cDNA library was constructed using
                     SMART cDNA Library Construction Kit. After that, 6000
                     random clones were sequenced by the ABI3730xl. BLAST
                     homology searches in the nr and nt databases in GenBank
                     were performed for each of the unigenes under Evalues of
                     1e-5. The unigenes were named after the homologous
                     sequences in GenBank. The annotated unigenes were then
                     matched to specific processes or functions using COG and
                     GO tools."
BASE COUNT          233 a          203 c          183 g          222 t
ORIGIN      
        1 ccatctcaga tagtggcgca gttattgcag tggtataggt tccagaaata aacgactgaa
       61 aagcaatggt tgctttcact gtgtatctcg gcatttcagc agtcttgttg atcatcgcct
      121 atttccggtt catctttcgt atccgaaggg acaaggaacc tccttatctt ccaggacatt
      181 ttctctgggg caatgcagcc gactttgcag agcacggtgt tcatttcatc aacagaagtc
      241 gtaagaaatt tggtgacgtt ttcacaattc gtgtgttgaa catgcacgtc accgtcatcg
      301 ctgaccccca tgcctacgag acgttcacac aagataaacg gtttgatttc ggtgagcttc
      361 aaaaacaagt taccactaac gtcttccatt gtgatctgaa aagaatagat aaatttgtcg
      421 acaggtcccg gcaatgggcg aacggaacat acttgaataa aataatgaaa aactttgaca
      481 tccatctgca agacgccctt catgacgtcg gggaatctaa ggaatctgaa aatggtctac
      541 tggaaaccta ttgccagtgg agaactgaga aacttgtcac cttcacctct gtaactctgt
      601 ggagagccat tttttactcc atgttcggac gtaaaaacag ctccaacctc gtgccagaag
      661 tgcaggagtt cactccatcg ggctccttca acaatctatc cagctatcac aagtttttca
      721 attacctttg gctgggcgtg ccggtacgat taattcccag agcattcaaa gcccgaaagg
      781 cgttaaacca gcagccacgg cccgaggtcc tcatggctcg agaaggagta tctgactaca
      841 t
//