LOCUS JK034237 841 bp mRNA linear EST 07-FEB-2014 DEFINITION 155 (LHA-2011) Bellamya aeruginosa normalized cDNA library Bellamya aeruginosa cDNA 5', mRNA sequence. ACCESSION JK034237 VERSION JK034237.1 DBLINK BioSample: SAMN00622379 KEYWORDS EST. SOURCE Sinotaia aeruginosa ORGANISM Sinotaia aeruginosa Eukaryota; Metazoa; Spiralia; Lophotrochozoa; Mollusca; Gastropoda; Caenogastropoda; Architaenioglossa; Viviparoidea; Viviparidae; Sinotaia. REFERENCE 1 (bases 1 to 841) AUTHORS An,L.H. and Zheng,B.H. TITLE Construction and Characterization of Normalized cDNA Library from the Snail Bellamya aeruginosa Exposure to Copper JOURNAL Unpublished COMMENT Contact: An L.H. State Environmental Protection Key Laboratory Of Estuarine And Coastal Research Chinese Research Academy For Environment Sciences 8 Dayangfang BeiYuan Road, Chaoyang District, Beijing 100012, China Tel: +86-10-84913914 Fax: +86-10-84913914 Email: anlh@craes.org.cn PCR PRimers FORWARD: CTCGGGAAGCGCGCCATTGTGTTGGT BACKWARD: ATACGTCTCACTATAGGGCGAATTGGCC. FEATURES Location/Qualifiers source 1..841 /organism="Sinotaia aeruginosa" /mol_type="mRNA" /db_xref="taxon:2653872" /tissue_type="gonads; digestive gland; peripheral tissue" /clone_lib="SAMN00622379 Bellamya aeruginosa normalized cDNA library" /dev_stage="mature" /note="Vector: Lambda TripEx2; 1.5 microliter RNA solution (1-3 microgram of total RNA) was normalized using CDS and SMART Oligo IV primer firstly, and then the reaction solution was reversed transcription for synthesizing the first-strand using MMLV reverse transcriptase (Promega, USA). Subsequently, PCR reaction was operated and cDNA was extracted using Promegas PCR clean-up system kit (Madison, USA). And then the cDNA library was constructed using SMART cDNA Library Construction Kit. After that, 6000 random clones were sequenced by the ABI3730xl. BLAST homology searches in the nr and nt databases in GenBank were performed for each of the unigenes under Evalues of 1e-5. The unigenes were named after the homologous sequences in GenBank. The annotated unigenes were then matched to specific processes or functions using COG and GO tools." BASE COUNT 233 a 203 c 183 g 222 t ORIGIN 1 ccatctcaga tagtggcgca gttattgcag tggtataggt tccagaaata aacgactgaa 61 aagcaatggt tgctttcact gtgtatctcg gcatttcagc agtcttgttg atcatcgcct 121 atttccggtt catctttcgt atccgaaggg acaaggaacc tccttatctt ccaggacatt 181 ttctctgggg caatgcagcc gactttgcag agcacggtgt tcatttcatc aacagaagtc 241 gtaagaaatt tggtgacgtt ttcacaattc gtgtgttgaa catgcacgtc accgtcatcg 301 ctgaccccca tgcctacgag acgttcacac aagataaacg gtttgatttc ggtgagcttc 361 aaaaacaagt taccactaac gtcttccatt gtgatctgaa aagaatagat aaatttgtcg 421 acaggtcccg gcaatgggcg aacggaacat acttgaataa aataatgaaa aactttgaca 481 tccatctgca agacgccctt catgacgtcg gggaatctaa ggaatctgaa aatggtctac 541 tggaaaccta ttgccagtgg agaactgaga aacttgtcac cttcacctct gtaactctgt 601 ggagagccat tttttactcc atgttcggac gtaaaaacag ctccaacctc gtgccagaag 661 tgcaggagtt cactccatcg ggctccttca acaatctatc cagctatcac aagtttttca 721 attacctttg gctgggcgtg ccggtacgat taattcccag agcattcaaa gcccgaaagg 781 cgttaaacca gcagccacgg cccgaggtcc tcatggctcg agaaggagta tctgactaca 841 t //