LOCUS JK034230 894 bp mRNA linear EST 07-FEB-2014 DEFINITION 148 (LHA-2011) Bellamya aeruginosa normalized cDNA library Bellamya aeruginosa cDNA 5', mRNA sequence. ACCESSION JK034230 VERSION JK034230.1 DBLINK BioSample: SAMN00622379 KEYWORDS EST. SOURCE Sinotaia aeruginosa ORGANISM Sinotaia aeruginosa Eukaryota; Metazoa; Spiralia; Lophotrochozoa; Mollusca; Gastropoda; Caenogastropoda; Architaenioglossa; Viviparoidea; Viviparidae; Sinotaia. REFERENCE 1 (bases 1 to 894) AUTHORS An,L.H. and Zheng,B.H. TITLE Construction and Characterization of Normalized cDNA Library from the Snail Bellamya aeruginosa Exposure to Copper JOURNAL Unpublished COMMENT Contact: An L.H. State Environmental Protection Key Laboratory Of Estuarine And Coastal Research Chinese Research Academy For Environment Sciences 8 Dayangfang BeiYuan Road, Chaoyang District, Beijing 100012, China Tel: +86-10-84913914 Fax: +86-10-84913914 Email: anlh@craes.org.cn PCR PRimers FORWARD: CTCGGGAAGCGCGCCATTGTGTTGGT BACKWARD: ATACGTCTCACTATAGGGCGAATTGGCC. FEATURES Location/Qualifiers source 1..894 /organism="Sinotaia aeruginosa" /mol_type="mRNA" /db_xref="taxon:2653872" /tissue_type="gonads; digestive gland; peripheral tissue" /clone_lib="SAMN00622379 Bellamya aeruginosa normalized cDNA library" /dev_stage="mature" /note="Vector: Lambda TripEx2; 1.5 microliter RNA solution (1-3 microgram of total RNA) was normalized using CDS and SMART Oligo IV primer firstly, and then the reaction solution was reversed transcription for synthesizing the first-strand using MMLV reverse transcriptase (Promega, USA). Subsequently, PCR reaction was operated and cDNA was extracted using Promegas PCR clean-up system kit (Madison, USA). And then the cDNA library was constructed using SMART cDNA Library Construction Kit. After that, 6000 random clones were sequenced by the ABI3730xl. BLAST homology searches in the nr and nt databases in GenBank were performed for each of the unigenes under Evalues of 1e-5. The unigenes were named after the homologous sequences in GenBank. The annotated unigenes were then matched to specific processes or functions using COG and GO tools." BASE COUNT 258 a 216 c 193 g 227 t ORIGIN 1 aagcgtcgta cattgttgcc gtgtacacac cttcctaagt gttgtctgtc agtgtcaagc 61 tcgtcagggg actgtgtatg cgacagtgcc aggccaggtg aatacgtcaa tttaaaacgc 121 ggcatcaaat ctaacagatg cgcaagggcc agcagtgtgt atatgtatac aaagacaaac 181 gcagttgcga gtcagcactg ggcgtgtagt ctcacttcag ttcaacgaag tcagtcagat 241 acgtttgggc ctaacggtta ggcggtagta caaaggcacc tgctgataca ggcactggag 301 cgtaacgcgt atgaggtgtc ggacttttct tccccgttta catcgaatta agcgattctt 361 tctagaaccg gaggatttcg tgacaagaac ataacagttt gttgaaaaca caagtatgat 421 tctaagacac atcctacttg gagtggccgt gctcactctg accatctctc tcactctcgg 481 ctataatact ggtgctcctg atataacttc tgtgtgcaac caaatgatgc cgtcacacga 541 tgtgcctcca cagacgacgt caccgcctta ctccataaca ttctcaccga acacctatac 601 acctggtgga ccgccaatta acgttacaat tcaggcgaac acaggaacaa acttcaaagg 661 gtttttgttg acagcccggt attctcaagc gtgtcaggac caaacctcta acattggcat 721 tttcattcaa gaatcaaaca caaatagaat ttgttctaat caagctataa cccacgcaac 781 aagtgactta aagacaaatg taactgtaca atggactcca cccgcaacca ctcagggtcc 841 tattgagttt agagcaactg tggtccaagt gaaaagtaca ttttggatta tatg //