LOCUS       JK034223                 876 bp    mRNA    linear   EST 07-FEB-2014
DEFINITION  141 (LHA-2011) Bellamya aeruginosa normalized cDNA library Bellamya
            aeruginosa cDNA 5', mRNA sequence.
ACCESSION   JK034223
VERSION     JK034223.1
DBLINK      BioSample: SAMN00622379
KEYWORDS    EST.
SOURCE      Sinotaia aeruginosa
  ORGANISM  Sinotaia aeruginosa
            Eukaryota; Metazoa; Spiralia; Lophotrochozoa; Mollusca; Gastropoda;
            Caenogastropoda; Architaenioglossa; Viviparoidea; Viviparidae;
            Sinotaia.
REFERENCE   1  (bases 1 to 876)
  AUTHORS   An,L.H. and Zheng,B.H.
  TITLE     Construction and Characterization of Normalized cDNA Library from
            the Snail Bellamya aeruginosa Exposure to Copper
  JOURNAL   Unpublished
COMMENT     Contact: An L.H.
            State Environmental Protection Key Laboratory Of Estuarine And
            Coastal Research
            Chinese Research Academy For Environment Sciences
            8 Dayangfang BeiYuan Road, Chaoyang District, Beijing 100012, China
            Tel: +86-10-84913914
            Fax: +86-10-84913914
            Email: anlh@craes.org.cn
            PCR PRimers
            FORWARD: CTCGGGAAGCGCGCCATTGTGTTGGT
            BACKWARD: ATACGTCTCACTATAGGGCGAATTGGCC.
FEATURES             Location/Qualifiers
     source          1..876
                     /organism="Sinotaia aeruginosa"
                     /mol_type="mRNA"
                     /db_xref="taxon:2653872"
                     /tissue_type="gonads; digestive gland; peripheral tissue"
                     /clone_lib="SAMN00622379 Bellamya aeruginosa normalized
                     cDNA library"
                     /dev_stage="mature"
                     /note="Vector: Lambda TripEx2; 1.5 microliter RNA solution
                     (1-3 microgram of total RNA) was normalized using CDS and
                     SMART Oligo IV primer firstly, and then the reaction
                     solution was reversed transcription for synthesizing the
                     first-strand using MMLV reverse transcriptase (Promega,
                     USA). Subsequently, PCR reaction was operated and cDNA was
                     extracted using Promegas PCR clean-up system kit (Madison,
                     USA). And then the cDNA library was constructed using
                     SMART cDNA Library Construction Kit. After that, 6000
                     random clones were sequenced by the ABI3730xl. BLAST
                     homology searches in the nr and nt databases in GenBank
                     were performed for each of the unigenes under Evalues of
                     1e-5. The unigenes were named after the homologous
                     sequences in GenBank. The annotated unigenes were then
                     matched to specific processes or functions using COG and
                     GO tools."
BASE COUNT          269 a          166 c          187 g          254 t
ORIGIN      
        1 gggacatgac gcttgaactg aaattaaata ttgataggtt tcatttctgt caagaacaac
       61 tctgatttga aaacctaaag ccgcatagca gtcgtattta aaatgtttgt atttaaattg
      121 cgaaatggta gttaggtata ttgtttatgt atacgcatta ttgtgcgtgt ttcatctttc
      181 tttcgctcct aactcggata ttacaagtac tgaacaagta tgcgcgtgta ctataggcga
      241 gtgcattttt gaagattgca cagatgaagt aaattgcaac agagaaaatg tcgcccttgg
      301 caagagtacc gaaattagtt cagtacattt cgatccgaat tttcttaaga aatttaccga
      361 taaggaccgg gacaatcttg gttgcctagc tgttaatggc attaccacac ctgtctatga
      421 acttgcactt aataagacca cggagcctaa ctgcattcag acagctacta atgacatgaa
      481 cccctcgtgg actgtattct ttggcaaaaa gtacgtcatc cagaacatta caatctacac
      541 acggaaatca tttgaaaaac acctttctaa cgtcactgtg acagtagaca atgtgatgtg
      601 ctacacattt ccgacacaga ctgtgatctt tcccgatgtg aatgaaattc agtgccatac
      661 acctttagaa ggcagtaatc tgaaacttca gaggaatact gatggtaacg aatcaagtat
      721 ggatcatgtc ctgacttttt gtgaactaca agtgtaggtg tgtaaggatg gctttttcgg
      781 cagtaaatgt gatctcaaat gcaaccctga cgcctgcaaa gggacgtgca acatcgagac
      841 aggggaatgc agtgggggtt gtaaagacgg tttcta
//