LOCUS JK034223 876 bp mRNA linear EST 07-FEB-2014 DEFINITION 141 (LHA-2011) Bellamya aeruginosa normalized cDNA library Bellamya aeruginosa cDNA 5', mRNA sequence. ACCESSION JK034223 VERSION JK034223.1 DBLINK BioSample: SAMN00622379 KEYWORDS EST. SOURCE Sinotaia aeruginosa ORGANISM Sinotaia aeruginosa Eukaryota; Metazoa; Spiralia; Lophotrochozoa; Mollusca; Gastropoda; Caenogastropoda; Architaenioglossa; Viviparoidea; Viviparidae; Sinotaia. REFERENCE 1 (bases 1 to 876) AUTHORS An,L.H. and Zheng,B.H. TITLE Construction and Characterization of Normalized cDNA Library from the Snail Bellamya aeruginosa Exposure to Copper JOURNAL Unpublished COMMENT Contact: An L.H. State Environmental Protection Key Laboratory Of Estuarine And Coastal Research Chinese Research Academy For Environment Sciences 8 Dayangfang BeiYuan Road, Chaoyang District, Beijing 100012, China Tel: +86-10-84913914 Fax: +86-10-84913914 Email: anlh@craes.org.cn PCR PRimers FORWARD: CTCGGGAAGCGCGCCATTGTGTTGGT BACKWARD: ATACGTCTCACTATAGGGCGAATTGGCC. FEATURES Location/Qualifiers source 1..876 /organism="Sinotaia aeruginosa" /mol_type="mRNA" /db_xref="taxon:2653872" /tissue_type="gonads; digestive gland; peripheral tissue" /clone_lib="SAMN00622379 Bellamya aeruginosa normalized cDNA library" /dev_stage="mature" /note="Vector: Lambda TripEx2; 1.5 microliter RNA solution (1-3 microgram of total RNA) was normalized using CDS and SMART Oligo IV primer firstly, and then the reaction solution was reversed transcription for synthesizing the first-strand using MMLV reverse transcriptase (Promega, USA). Subsequently, PCR reaction was operated and cDNA was extracted using Promegas PCR clean-up system kit (Madison, USA). And then the cDNA library was constructed using SMART cDNA Library Construction Kit. After that, 6000 random clones were sequenced by the ABI3730xl. BLAST homology searches in the nr and nt databases in GenBank were performed for each of the unigenes under Evalues of 1e-5. The unigenes were named after the homologous sequences in GenBank. The annotated unigenes were then matched to specific processes or functions using COG and GO tools." BASE COUNT 269 a 166 c 187 g 254 t ORIGIN 1 gggacatgac gcttgaactg aaattaaata ttgataggtt tcatttctgt caagaacaac 61 tctgatttga aaacctaaag ccgcatagca gtcgtattta aaatgtttgt atttaaattg 121 cgaaatggta gttaggtata ttgtttatgt atacgcatta ttgtgcgtgt ttcatctttc 181 tttcgctcct aactcggata ttacaagtac tgaacaagta tgcgcgtgta ctataggcga 241 gtgcattttt gaagattgca cagatgaagt aaattgcaac agagaaaatg tcgcccttgg 301 caagagtacc gaaattagtt cagtacattt cgatccgaat tttcttaaga aatttaccga 361 taaggaccgg gacaatcttg gttgcctagc tgttaatggc attaccacac ctgtctatga 421 acttgcactt aataagacca cggagcctaa ctgcattcag acagctacta atgacatgaa 481 cccctcgtgg actgtattct ttggcaaaaa gtacgtcatc cagaacatta caatctacac 541 acggaaatca tttgaaaaac acctttctaa cgtcactgtg acagtagaca atgtgatgtg 601 ctacacattt ccgacacaga ctgtgatctt tcccgatgtg aatgaaattc agtgccatac 661 acctttagaa ggcagtaatc tgaaacttca gaggaatact gatggtaacg aatcaagtat 721 ggatcatgtc ctgacttttt gtgaactaca agtgtaggtg tgtaaggatg gctttttcgg 781 cagtaaatgt gatctcaaat gcaaccctga cgcctgcaaa gggacgtgca acatcgagac 841 aggggaatgc agtgggggtt gtaaagacgg tttcta //