LOCUS       JK034216                 766 bp    mRNA    linear   EST 07-FEB-2014
DEFINITION  134 (LHA-2011) Bellamya aeruginosa normalized cDNA library Bellamya
            aeruginosa cDNA 5', mRNA sequence.
ACCESSION   JK034216
VERSION     JK034216.1
DBLINK      BioSample: SAMN00622379
KEYWORDS    EST.
SOURCE      Sinotaia aeruginosa
  ORGANISM  Sinotaia aeruginosa
            Eukaryota; Metazoa; Spiralia; Lophotrochozoa; Mollusca; Gastropoda;
            Caenogastropoda; Architaenioglossa; Viviparoidea; Viviparidae;
            Sinotaia.
REFERENCE   1  (bases 1 to 766)
  AUTHORS   An,L.H. and Zheng,B.H.
  TITLE     Construction and Characterization of Normalized cDNA Library from
            the Snail Bellamya aeruginosa Exposure to Copper
  JOURNAL   Unpublished
COMMENT     Contact: An L.H.
            State Environmental Protection Key Laboratory Of Estuarine And
            Coastal Research
            Chinese Research Academy For Environment Sciences
            8 Dayangfang BeiYuan Road, Chaoyang District, Beijing 100012, China
            Tel: +86-10-84913914
            Fax: +86-10-84913914
            Email: anlh@craes.org.cn
            PCR PRimers
            FORWARD: CTCGGGAAGCGCGCCATTGTGTTGGT
            BACKWARD: ATACGTCTCACTATAGGGCGAATTGGCC.
FEATURES             Location/Qualifiers
     source          1..766
                     /organism="Sinotaia aeruginosa"
                     /mol_type="mRNA"
                     /db_xref="taxon:2653872"
                     /tissue_type="gonads; digestive gland; peripheral tissue"
                     /clone_lib="SAMN00622379 Bellamya aeruginosa normalized
                     cDNA library"
                     /dev_stage="mature"
                     /note="Vector: Lambda TripEx2; 1.5 microliter RNA solution
                     (1-3 microgram of total RNA) was normalized using CDS and
                     SMART Oligo IV primer firstly, and then the reaction
                     solution was reversed transcription for synthesizing the
                     first-strand using MMLV reverse transcriptase (Promega,
                     USA). Subsequently, PCR reaction was operated and cDNA was
                     extracted using Promegas PCR clean-up system kit (Madison,
                     USA). And then the cDNA library was constructed using
                     SMART cDNA Library Construction Kit. After that, 6000
                     random clones were sequenced by the ABI3730xl. BLAST
                     homology searches in the nr and nt databases in GenBank
                     were performed for each of the unigenes under Evalues of
                     1e-5. The unigenes were named after the homologous
                     sequences in GenBank. The annotated unigenes were then
                     matched to specific processes or functions using COG and
                     GO tools."
BASE COUNT          213 a          208 c          160 g          185 t
ORIGIN      
        1 ggctgcagaa gtaatatcca acgaccagtc gtgtattaac actccagcag ataacagtgt
       61 aatatttcaa cgacttttcg acagttggac gctaacttca ggcagccatg gcattactac
      121 agaccttgac attgtcactg caactcgccg ttctcttctt gctacccaag acaatggcat
      181 tggcattgag cactaccgga tacccttcta caacaaccct gacctccacc acagacttcc
      241 aaactaccac cacagacttc caaactacca ccccgccagt ttgtatgcta tggggaatcc
      301 caaggccaga cttacgacct ggtgaagcga catcaacaag ttgcgagcac tgttactgtg
      361 acctgaacta tcaagctcag tgtatgagag caaggtgcac cactcctgct tattgtacaa
      421 atcccgtgct gcgtccaggg gaatgttgcc catattgtga gacactcaca actacagaaa
      481 tgccgactac cactccttca ggatgtgttc tggacaatgg aactatacta cctgagggcg
      541 agaagatcgt caccaaaatg tatggttctt gtcaaatgat ctcttgtcgt gattcccagc
      601 tagccactat atatgcagac tgtattcctg ccatgtgtgt ggacgcgctg gaaacgaact
      661 gttgtcagta ttgtcccaat ggtcagaact gccgacttcc aaacggaagc ctactgtatg
      721 gttcaaatcc acaagagatc gacggaatga catgccagtg tccaga
//