LOCUS JK034216 766 bp mRNA linear EST 07-FEB-2014 DEFINITION 134 (LHA-2011) Bellamya aeruginosa normalized cDNA library Bellamya aeruginosa cDNA 5', mRNA sequence. ACCESSION JK034216 VERSION JK034216.1 DBLINK BioSample: SAMN00622379 KEYWORDS EST. SOURCE Sinotaia aeruginosa ORGANISM Sinotaia aeruginosa Eukaryota; Metazoa; Spiralia; Lophotrochozoa; Mollusca; Gastropoda; Caenogastropoda; Architaenioglossa; Viviparoidea; Viviparidae; Sinotaia. REFERENCE 1 (bases 1 to 766) AUTHORS An,L.H. and Zheng,B.H. TITLE Construction and Characterization of Normalized cDNA Library from the Snail Bellamya aeruginosa Exposure to Copper JOURNAL Unpublished COMMENT Contact: An L.H. State Environmental Protection Key Laboratory Of Estuarine And Coastal Research Chinese Research Academy For Environment Sciences 8 Dayangfang BeiYuan Road, Chaoyang District, Beijing 100012, China Tel: +86-10-84913914 Fax: +86-10-84913914 Email: anlh@craes.org.cn PCR PRimers FORWARD: CTCGGGAAGCGCGCCATTGTGTTGGT BACKWARD: ATACGTCTCACTATAGGGCGAATTGGCC. FEATURES Location/Qualifiers source 1..766 /organism="Sinotaia aeruginosa" /mol_type="mRNA" /db_xref="taxon:2653872" /tissue_type="gonads; digestive gland; peripheral tissue" /clone_lib="SAMN00622379 Bellamya aeruginosa normalized cDNA library" /dev_stage="mature" /note="Vector: Lambda TripEx2; 1.5 microliter RNA solution (1-3 microgram of total RNA) was normalized using CDS and SMART Oligo IV primer firstly, and then the reaction solution was reversed transcription for synthesizing the first-strand using MMLV reverse transcriptase (Promega, USA). Subsequently, PCR reaction was operated and cDNA was extracted using Promegas PCR clean-up system kit (Madison, USA). And then the cDNA library was constructed using SMART cDNA Library Construction Kit. After that, 6000 random clones were sequenced by the ABI3730xl. BLAST homology searches in the nr and nt databases in GenBank were performed for each of the unigenes under Evalues of 1e-5. The unigenes were named after the homologous sequences in GenBank. The annotated unigenes were then matched to specific processes or functions using COG and GO tools." BASE COUNT 213 a 208 c 160 g 185 t ORIGIN 1 ggctgcagaa gtaatatcca acgaccagtc gtgtattaac actccagcag ataacagtgt 61 aatatttcaa cgacttttcg acagttggac gctaacttca ggcagccatg gcattactac 121 agaccttgac attgtcactg caactcgccg ttctcttctt gctacccaag acaatggcat 181 tggcattgag cactaccgga tacccttcta caacaaccct gacctccacc acagacttcc 241 aaactaccac cacagacttc caaactacca ccccgccagt ttgtatgcta tggggaatcc 301 caaggccaga cttacgacct ggtgaagcga catcaacaag ttgcgagcac tgttactgtg 361 acctgaacta tcaagctcag tgtatgagag caaggtgcac cactcctgct tattgtacaa 421 atcccgtgct gcgtccaggg gaatgttgcc catattgtga gacactcaca actacagaaa 481 tgccgactac cactccttca ggatgtgttc tggacaatgg aactatacta cctgagggcg 541 agaagatcgt caccaaaatg tatggttctt gtcaaatgat ctcttgtcgt gattcccagc 601 tagccactat atatgcagac tgtattcctg ccatgtgtgt ggacgcgctg gaaacgaact 661 gttgtcagta ttgtcccaat ggtcagaact gccgacttcc aaacggaagc ctactgtatg 721 gttcaaatcc acaagagatc gacggaatga catgccagtg tccaga //