LOCUS       JK034209                 880 bp    mRNA    linear   EST 07-FEB-2014
DEFINITION  127 (LHA-2011) Bellamya aeruginosa normalized cDNA library Bellamya
            aeruginosa cDNA 5', mRNA sequence.
ACCESSION   JK034209
VERSION     JK034209.1
DBLINK      BioSample: SAMN00622379
KEYWORDS    EST.
SOURCE      Sinotaia aeruginosa
  ORGANISM  Sinotaia aeruginosa
            Eukaryota; Metazoa; Spiralia; Lophotrochozoa; Mollusca; Gastropoda;
            Caenogastropoda; Architaenioglossa; Viviparoidea; Viviparidae;
            Sinotaia.
REFERENCE   1  (bases 1 to 880)
  AUTHORS   An,L.H. and Zheng,B.H.
  TITLE     Construction and Characterization of Normalized cDNA Library from
            the Snail Bellamya aeruginosa Exposure to Copper
  JOURNAL   Unpublished
COMMENT     Contact: An L.H.
            State Environmental Protection Key Laboratory Of Estuarine And
            Coastal Research
            Chinese Research Academy For Environment Sciences
            8 Dayangfang BeiYuan Road, Chaoyang District, Beijing 100012, China
            Tel: +86-10-84913914
            Fax: +86-10-84913914
            Email: anlh@craes.org.cn
            PCR PRimers
            FORWARD: CTCGGGAAGCGCGCCATTGTGTTGGT
            BACKWARD: ATACGTCTCACTATAGGGCGAATTGGCC.
FEATURES             Location/Qualifiers
     source          1..880
                     /organism="Sinotaia aeruginosa"
                     /mol_type="mRNA"
                     /db_xref="taxon:2653872"
                     /tissue_type="gonads; digestive gland; peripheral tissue"
                     /clone_lib="SAMN00622379 Bellamya aeruginosa normalized
                     cDNA library"
                     /dev_stage="mature"
                     /note="Vector: Lambda TripEx2; 1.5 microliter RNA solution
                     (1-3 microgram of total RNA) was normalized using CDS and
                     SMART Oligo IV primer firstly, and then the reaction
                     solution was reversed transcription for synthesizing the
                     first-strand using MMLV reverse transcriptase (Promega,
                     USA). Subsequently, PCR reaction was operated and cDNA was
                     extracted using Promegas PCR clean-up system kit (Madison,
                     USA). And then the cDNA library was constructed using
                     SMART cDNA Library Construction Kit. After that, 6000
                     random clones were sequenced by the ABI3730xl. BLAST
                     homology searches in the nr and nt databases in GenBank
                     were performed for each of the unigenes under Evalues of
                     1e-5. The unigenes were named after the homologous
                     sequences in GenBank. The annotated unigenes were then
                     matched to specific processes or functions using COG and
                     GO tools."
BASE COUNT          288 a          177 c          191 g          224 t
ORIGIN      
        1 tgacttgaga tttcacacat tcagtcacta aagagttgtc ttcccattgt ccgattatta
       61 ggtgcagaac cacgatagtg aacgaagaca aaggttccga ataaattatc ttcagtcact
      121 taatgcaaaa gcgaggacct attccaggag cagatatttg ttaaaaataa aaaaagaaaa
      181 atatcgcaac actaagatgg atgctgtttt tcctgctaaa gcggatacga aatcctgtaa
      241 gcaaacagca ggagtcgcac gatgttgtgc tgcaagcaca agggacgttg aaggcaaaac
      301 gtgtcttata tttcgcctca acaaaatttg tcagcttgat gaggttctgc cgatttttaa
      361 gtccaatgag gtggatatag tgcacattga atctagacca tctggagaag gcaacacgtt
      421 tgatatcttt ctggcttgcg atctcccaga aggaaagttg gaaatgattg cctcccttca
      481 aaagtttact gaaaatctgg aagtgcacta ccctggtgtt tcgaaagaac aagatgaatt
      541 cctaattgta aatggtcaaa aagtgccatg gtttccgcgt actatcaaag aagttgaccg
      601 ttttgccaat aaagtgctta actgcggagc cgaactcgaa gcggaccacc ctggtttcca
      661 agaccaggtg tatagagcta ggagaaagga gtttgctgat gttgcaatca actatcgaca
      721 tggtcaacca attccaagag cagaatacac acaggaggag atcaatacat ggaataccgt
      781 ctttaaagag ctgacaaaac tttacccgac caatgcctgc aaagaattta acgatgcctt
      841 tccactgctt attgaaaaat gtggattccg cgagaacaca
//