LOCUS JK034209 880 bp mRNA linear EST 07-FEB-2014 DEFINITION 127 (LHA-2011) Bellamya aeruginosa normalized cDNA library Bellamya aeruginosa cDNA 5', mRNA sequence. ACCESSION JK034209 VERSION JK034209.1 DBLINK BioSample: SAMN00622379 KEYWORDS EST. SOURCE Sinotaia aeruginosa ORGANISM Sinotaia aeruginosa Eukaryota; Metazoa; Spiralia; Lophotrochozoa; Mollusca; Gastropoda; Caenogastropoda; Architaenioglossa; Viviparoidea; Viviparidae; Sinotaia. REFERENCE 1 (bases 1 to 880) AUTHORS An,L.H. and Zheng,B.H. TITLE Construction and Characterization of Normalized cDNA Library from the Snail Bellamya aeruginosa Exposure to Copper JOURNAL Unpublished COMMENT Contact: An L.H. State Environmental Protection Key Laboratory Of Estuarine And Coastal Research Chinese Research Academy For Environment Sciences 8 Dayangfang BeiYuan Road, Chaoyang District, Beijing 100012, China Tel: +86-10-84913914 Fax: +86-10-84913914 Email: anlh@craes.org.cn PCR PRimers FORWARD: CTCGGGAAGCGCGCCATTGTGTTGGT BACKWARD: ATACGTCTCACTATAGGGCGAATTGGCC. FEATURES Location/Qualifiers source 1..880 /organism="Sinotaia aeruginosa" /mol_type="mRNA" /db_xref="taxon:2653872" /tissue_type="gonads; digestive gland; peripheral tissue" /clone_lib="SAMN00622379 Bellamya aeruginosa normalized cDNA library" /dev_stage="mature" /note="Vector: Lambda TripEx2; 1.5 microliter RNA solution (1-3 microgram of total RNA) was normalized using CDS and SMART Oligo IV primer firstly, and then the reaction solution was reversed transcription for synthesizing the first-strand using MMLV reverse transcriptase (Promega, USA). Subsequently, PCR reaction was operated and cDNA was extracted using Promegas PCR clean-up system kit (Madison, USA). And then the cDNA library was constructed using SMART cDNA Library Construction Kit. After that, 6000 random clones were sequenced by the ABI3730xl. BLAST homology searches in the nr and nt databases in GenBank were performed for each of the unigenes under Evalues of 1e-5. The unigenes were named after the homologous sequences in GenBank. The annotated unigenes were then matched to specific processes or functions using COG and GO tools." BASE COUNT 288 a 177 c 191 g 224 t ORIGIN 1 tgacttgaga tttcacacat tcagtcacta aagagttgtc ttcccattgt ccgattatta 61 ggtgcagaac cacgatagtg aacgaagaca aaggttccga ataaattatc ttcagtcact 121 taatgcaaaa gcgaggacct attccaggag cagatatttg ttaaaaataa aaaaagaaaa 181 atatcgcaac actaagatgg atgctgtttt tcctgctaaa gcggatacga aatcctgtaa 241 gcaaacagca ggagtcgcac gatgttgtgc tgcaagcaca agggacgttg aaggcaaaac 301 gtgtcttata tttcgcctca acaaaatttg tcagcttgat gaggttctgc cgatttttaa 361 gtccaatgag gtggatatag tgcacattga atctagacca tctggagaag gcaacacgtt 421 tgatatcttt ctggcttgcg atctcccaga aggaaagttg gaaatgattg cctcccttca 481 aaagtttact gaaaatctgg aagtgcacta ccctggtgtt tcgaaagaac aagatgaatt 541 cctaattgta aatggtcaaa aagtgccatg gtttccgcgt actatcaaag aagttgaccg 601 ttttgccaat aaagtgctta actgcggagc cgaactcgaa gcggaccacc ctggtttcca 661 agaccaggtg tatagagcta ggagaaagga gtttgctgat gttgcaatca actatcgaca 721 tggtcaacca attccaagag cagaatacac acaggaggag atcaatacat ggaataccgt 781 ctttaaagag ctgacaaaac tttacccgac caatgcctgc aaagaattta acgatgcctt 841 tccactgctt attgaaaaat gtggattccg cgagaacaca //