LOCUS JK034195 845 bp mRNA linear EST 07-FEB-2014 DEFINITION 113 (LHA-2011) Bellamya aeruginosa normalized cDNA library Bellamya aeruginosa cDNA 5', mRNA sequence. ACCESSION JK034195 VERSION JK034195.1 DBLINK BioSample: SAMN00622379 KEYWORDS EST. SOURCE Sinotaia aeruginosa ORGANISM Sinotaia aeruginosa Eukaryota; Metazoa; Spiralia; Lophotrochozoa; Mollusca; Gastropoda; Caenogastropoda; Architaenioglossa; Viviparoidea; Viviparidae; Sinotaia. REFERENCE 1 (bases 1 to 845) AUTHORS An,L.H. and Zheng,B.H. TITLE Construction and Characterization of Normalized cDNA Library from the Snail Bellamya aeruginosa Exposure to Copper JOURNAL Unpublished COMMENT Contact: An L.H. State Environmental Protection Key Laboratory Of Estuarine And Coastal Research Chinese Research Academy For Environment Sciences 8 Dayangfang BeiYuan Road, Chaoyang District, Beijing 100012, China Tel: +86-10-84913914 Fax: +86-10-84913914 Email: anlh@craes.org.cn PCR PRimers FORWARD: CTCGGGAAGCGCGCCATTGTGTTGGT BACKWARD: ATACGTCTCACTATAGGGCGAATTGGCC. FEATURES Location/Qualifiers source 1..845 /organism="Sinotaia aeruginosa" /mol_type="mRNA" /db_xref="taxon:2653872" /tissue_type="gonads; digestive gland; peripheral tissue" /clone_lib="SAMN00622379 Bellamya aeruginosa normalized cDNA library" /dev_stage="mature" /note="Vector: Lambda TripEx2; 1.5 microliter RNA solution (1-3 microgram of total RNA) was normalized using CDS and SMART Oligo IV primer firstly, and then the reaction solution was reversed transcription for synthesizing the first-strand using MMLV reverse transcriptase (Promega, USA). Subsequently, PCR reaction was operated and cDNA was extracted using Promegas PCR clean-up system kit (Madison, USA). And then the cDNA library was constructed using SMART cDNA Library Construction Kit. After that, 6000 random clones were sequenced by the ABI3730xl. BLAST homology searches in the nr and nt databases in GenBank were performed for each of the unigenes under Evalues of 1e-5. The unigenes were named after the homologous sequences in GenBank. The annotated unigenes were then matched to specific processes or functions using COG and GO tools." BASE COUNT 240 a 182 c 183 g 240 t ORIGIN 1 cttgacagaa atatcgaaac tgctatgtta atttgtgctg ccaactgtaa ttttaaacta 61 aaccatgtca aaagaagcag caatgaaaga agaatcccat tccgaaattg aggctgagac 121 tgtggatgat gatcacactg cagaggatga ttttattcaa cagttcgcac aagcactgca 181 tgtacaagat gttccacaag tacttgaaga ggtcagtttt gaaggcgtgg tcaaatacat 241 agccagcgga aagtgcaaga acatcattac tatggttggg gctggcatat ctacttcggc 301 tggaatcccc gacttcagaa gtcctggaac agggttgtat gataatctgc aatcctacaa 361 ccttcctaat ccacaggcca tctttatgat tgactttttc atgaaaaatc ccaaaccatt 421 ctttgttctt gccaaggcat tataccctgg tgctttcaaa cctacaccaa gccattactt 481 tgtccggctt ttgcatgaaa aaggtttgct tcttcgccat tacacacaga acattgacac 541 cttagaacga gtggctggat tgcccgagga gaagctcgtg gaggcgcatg gaacatttca 601 gacttcacac tgcttggagt gttctgctca gtactcattg ccttggatga aggaaaaaat 661 tttttcagat gaagtaccca cttgtgaaga agatggatgt acaggactga ttaaaccaga 721 cattgttttc tttggagaga gtcttccacc acgctttgtt cagtgtgtga cacaggattt 781 cacgaaatgt gacttgctga tagtgatggg aacctctctt gtggtccatc cgtttgcctc 841 cctta //