LOCUS       JK034188                 895 bp    mRNA    linear   EST 07-FEB-2014
DEFINITION  106 (LHA-2011) Bellamya aeruginosa normalized cDNA library Bellamya
            aeruginosa cDNA 5', mRNA sequence.
ACCESSION   JK034188
VERSION     JK034188.1
DBLINK      BioSample: SAMN00622379
KEYWORDS    EST.
SOURCE      Sinotaia aeruginosa
  ORGANISM  Sinotaia aeruginosa
            Eukaryota; Metazoa; Spiralia; Lophotrochozoa; Mollusca; Gastropoda;
            Caenogastropoda; Architaenioglossa; Viviparoidea; Viviparidae;
            Sinotaia.
REFERENCE   1  (bases 1 to 895)
  AUTHORS   An,L.H. and Zheng,B.H.
  TITLE     Construction and Characterization of Normalized cDNA Library from
            the Snail Bellamya aeruginosa Exposure to Copper
  JOURNAL   Unpublished
COMMENT     Contact: An L.H.
            State Environmental Protection Key Laboratory Of Estuarine And
            Coastal Research
            Chinese Research Academy For Environment Sciences
            8 Dayangfang BeiYuan Road, Chaoyang District, Beijing 100012, China
            Tel: +86-10-84913914
            Fax: +86-10-84913914
            Email: anlh@craes.org.cn
            PCR PRimers
            FORWARD: CTCGGGAAGCGCGCCATTGTGTTGGT
            BACKWARD: ATACGTCTCACTATAGGGCGAATTGGCC.
FEATURES             Location/Qualifiers
     source          1..895
                     /organism="Sinotaia aeruginosa"
                     /mol_type="mRNA"
                     /db_xref="taxon:2653872"
                     /tissue_type="gonads; digestive gland; peripheral tissue"
                     /clone_lib="SAMN00622379 Bellamya aeruginosa normalized
                     cDNA library"
                     /dev_stage="mature"
                     /note="Vector: Lambda TripEx2; 1.5 microliter RNA solution
                     (1-3 microgram of total RNA) was normalized using CDS and
                     SMART Oligo IV primer firstly, and then the reaction
                     solution was reversed transcription for synthesizing the
                     first-strand using MMLV reverse transcriptase (Promega,
                     USA). Subsequently, PCR reaction was operated and cDNA was
                     extracted using Promegas PCR clean-up system kit (Madison,
                     USA). And then the cDNA library was constructed using
                     SMART cDNA Library Construction Kit. After that, 6000
                     random clones were sequenced by the ABI3730xl. BLAST
                     homology searches in the nr and nt databases in GenBank
                     were performed for each of the unigenes under Evalues of
                     1e-5. The unigenes were named after the homologous
                     sequences in GenBank. The annotated unigenes were then
                     matched to specific processes or functions using COG and
                     GO tools."
BASE COUNT          310 a          164 c          204 g          217 t
ORIGIN      
        1 tgcttcccga gtctgttctt cattaacctt gttggcaaga agcaactcaa gagtagcact
       61 tacaagttat ttgcagttaa gacaactggc atctgaagcg caatgtacac cgggtcagtg
      121 gcagctggtc agtgcagtgt gcctgcaaag gatgcctgtt atcactgcga agaaaactaa
      181 gctagagcag cgcttcttag atatgatgac caagatcgaa cttgagaaga gtttgctgtc
      241 ggatcatgag ctcaaatcaa tcgacgataa agccattgca gacaagcgaa aacaagaagg
      301 gagtgaggac acagacgtag aaaaaataac acagacagct ctagacttag aagatgcatg
      361 ggaagctgaa gcaaagcagt ttacaccagc tcctagaacc acagaagcag atgttaaaaa
      421 tgatcttcat tcaacagatc gtgagctgga tcgaacatta ttcctactag taaaacaaaa
      481 aattggtgat aaaacacaat ggatttttcc acaaggacca cacttgaaag gagagtcaat
      541 gagacaggca gcagaacgag tattgcacag ccactgtggg aaagatgtaa aagcaacatt
      601 cttagggaat gcaccttgtg gtttctacca atataacttc cctcctgaag atggaacagg
      661 aaatggagct aaggtcttct tctttaaagc ctggcatgaa gaaggtagtg tggagctgga
      721 tatgaaaatc acatctgatt ttatgtgggt tactagggat gaattaccaa aattttgttc
      781 aaaggcatat ctcaagagca ttaagaaatt tcttgtagat ttgtaacagg tgatgtacag
      841 tttcatcctg ttgatctgaa aggctgcagc ataaataata aataaaacaa aatgc
//