LOCUS JK034188 895 bp mRNA linear EST 07-FEB-2014 DEFINITION 106 (LHA-2011) Bellamya aeruginosa normalized cDNA library Bellamya aeruginosa cDNA 5', mRNA sequence. ACCESSION JK034188 VERSION JK034188.1 DBLINK BioSample: SAMN00622379 KEYWORDS EST. SOURCE Sinotaia aeruginosa ORGANISM Sinotaia aeruginosa Eukaryota; Metazoa; Spiralia; Lophotrochozoa; Mollusca; Gastropoda; Caenogastropoda; Architaenioglossa; Viviparoidea; Viviparidae; Sinotaia. REFERENCE 1 (bases 1 to 895) AUTHORS An,L.H. and Zheng,B.H. TITLE Construction and Characterization of Normalized cDNA Library from the Snail Bellamya aeruginosa Exposure to Copper JOURNAL Unpublished COMMENT Contact: An L.H. State Environmental Protection Key Laboratory Of Estuarine And Coastal Research Chinese Research Academy For Environment Sciences 8 Dayangfang BeiYuan Road, Chaoyang District, Beijing 100012, China Tel: +86-10-84913914 Fax: +86-10-84913914 Email: anlh@craes.org.cn PCR PRimers FORWARD: CTCGGGAAGCGCGCCATTGTGTTGGT BACKWARD: ATACGTCTCACTATAGGGCGAATTGGCC. FEATURES Location/Qualifiers source 1..895 /organism="Sinotaia aeruginosa" /mol_type="mRNA" /db_xref="taxon:2653872" /tissue_type="gonads; digestive gland; peripheral tissue" /clone_lib="SAMN00622379 Bellamya aeruginosa normalized cDNA library" /dev_stage="mature" /note="Vector: Lambda TripEx2; 1.5 microliter RNA solution (1-3 microgram of total RNA) was normalized using CDS and SMART Oligo IV primer firstly, and then the reaction solution was reversed transcription for synthesizing the first-strand using MMLV reverse transcriptase (Promega, USA). Subsequently, PCR reaction was operated and cDNA was extracted using Promegas PCR clean-up system kit (Madison, USA). And then the cDNA library was constructed using SMART cDNA Library Construction Kit. After that, 6000 random clones were sequenced by the ABI3730xl. BLAST homology searches in the nr and nt databases in GenBank were performed for each of the unigenes under Evalues of 1e-5. The unigenes were named after the homologous sequences in GenBank. The annotated unigenes were then matched to specific processes or functions using COG and GO tools." BASE COUNT 310 a 164 c 204 g 217 t ORIGIN 1 tgcttcccga gtctgttctt cattaacctt gttggcaaga agcaactcaa gagtagcact 61 tacaagttat ttgcagttaa gacaactggc atctgaagcg caatgtacac cgggtcagtg 121 gcagctggtc agtgcagtgt gcctgcaaag gatgcctgtt atcactgcga agaaaactaa 181 gctagagcag cgcttcttag atatgatgac caagatcgaa cttgagaaga gtttgctgtc 241 ggatcatgag ctcaaatcaa tcgacgataa agccattgca gacaagcgaa aacaagaagg 301 gagtgaggac acagacgtag aaaaaataac acagacagct ctagacttag aagatgcatg 361 ggaagctgaa gcaaagcagt ttacaccagc tcctagaacc acagaagcag atgttaaaaa 421 tgatcttcat tcaacagatc gtgagctgga tcgaacatta ttcctactag taaaacaaaa 481 aattggtgat aaaacacaat ggatttttcc acaaggacca cacttgaaag gagagtcaat 541 gagacaggca gcagaacgag tattgcacag ccactgtggg aaagatgtaa aagcaacatt 601 cttagggaat gcaccttgtg gtttctacca atataacttc cctcctgaag atggaacagg 661 aaatggagct aaggtcttct tctttaaagc ctggcatgaa gaaggtagtg tggagctgga 721 tatgaaaatc acatctgatt ttatgtgggt tactagggat gaattaccaa aattttgttc 781 aaaggcatat ctcaagagca ttaagaaatt tcttgtagat ttgtaacagg tgatgtacag 841 tttcatcctg ttgatctgaa aggctgcagc ataaataata aataaaacaa aatgc //