LOCUS JK034181 836 bp mRNA linear EST 07-FEB-2014 DEFINITION 99 (LHA-2011) Bellamya aeruginosa normalized cDNA library Bellamya aeruginosa cDNA 5', mRNA sequence. ACCESSION JK034181 VERSION JK034181.1 DBLINK BioSample: SAMN00622379 KEYWORDS EST. SOURCE Sinotaia aeruginosa ORGANISM Sinotaia aeruginosa Eukaryota; Metazoa; Spiralia; Lophotrochozoa; Mollusca; Gastropoda; Caenogastropoda; Architaenioglossa; Viviparoidea; Viviparidae; Sinotaia. REFERENCE 1 (bases 1 to 836) AUTHORS An,L.H. and Zheng,B.H. TITLE Construction and Characterization of Normalized cDNA Library from the Snail Bellamya aeruginosa Exposure to Copper JOURNAL Unpublished COMMENT Contact: An L.H. State Environmental Protection Key Laboratory Of Estuarine And Coastal Research Chinese Research Academy For Environment Sciences 8 Dayangfang BeiYuan Road, Chaoyang District, Beijing 100012, China Tel: +86-10-84913914 Fax: +86-10-84913914 Email: anlh@craes.org.cn PCR PRimers FORWARD: CTCGGGAAGCGCGCCATTGTGTTGGT BACKWARD: ATACGTCTCACTATAGGGCGAATTGGCC. FEATURES Location/Qualifiers source 1..836 /organism="Sinotaia aeruginosa" /mol_type="mRNA" /db_xref="taxon:2653872" /tissue_type="gonads; digestive gland; peripheral tissue" /clone_lib="SAMN00622379 Bellamya aeruginosa normalized cDNA library" /dev_stage="mature" /note="Vector: Lambda TripEx2; 1.5 microliter RNA solution (1-3 microgram of total RNA) was normalized using CDS and SMART Oligo IV primer firstly, and then the reaction solution was reversed transcription for synthesizing the first-strand using MMLV reverse transcriptase (Promega, USA). Subsequently, PCR reaction was operated and cDNA was extracted using Promegas PCR clean-up system kit (Madison, USA). And then the cDNA library was constructed using SMART cDNA Library Construction Kit. After that, 6000 random clones were sequenced by the ABI3730xl. BLAST homology searches in the nr and nt databases in GenBank were performed for each of the unigenes under Evalues of 1e-5. The unigenes were named after the homologous sequences in GenBank. The annotated unigenes were then matched to specific processes or functions using COG and GO tools." BASE COUNT 234 a 166 c 191 g 245 t ORIGIN 1 ttgctttcgc cgcaaacatg gtgggctaac tcagaaatag aagcagatta tgatccatat 61 gtatactatg gagccagttc agattatgag atgcacacag gagatcctag gcaggatcta 121 gaatatgagg ggcagtacca gagcagctat attgcaccag aagtcataaa aaattttctt 181 cttttcacgc aaaaatgcat cagtgatcaa aatctttttg aggtccagaa ctgctatgag 241 aatggtttca acaagctgac agatcgtttc ttcaaaaatt caccttggcc agaagctgat 301 gttgttgctc caattgttgg caatgaccaa gttttcctga ttttgtacaa ggaactgtac 361 tataggcatg tgtatgcacg tgtacagggt ggtccttctt tggaacagcg atttgagtcc 421 tactacaatt actgcaactt gttcaattac attttaaatg ctgatggccc tgtgcctatg 481 gagttgccaa accagtggct ttgggatatt attgatgagt tcatctatca gttccagtct 541 ttcagcatgt atcgcagcaa actaacaaag aagactgaag atgaaattga ggtccttaga 601 accaatccaa agatttggaa tgtgcacagt gtgctgaatg tgttgcactc tcttgttgag 661 aaatctagca ttaaccgcca gctggaggtg tatgccaatg gagcaggtaa cccagaaagt 721 gttgccggtg agtttggaca acactccctc tacaagatgc tgggttactt tagcttgatt 781 ggactactgc gtttgcactc tttgttgggt gactactacc aggctctcaa ggtcct //