LOCUS JK034174 875 bp mRNA linear EST 07-FEB-2014 DEFINITION 92 (LHA-2011) Bellamya aeruginosa normalized cDNA library Bellamya aeruginosa cDNA 5', mRNA sequence. ACCESSION JK034174 VERSION JK034174.1 DBLINK BioSample: SAMN00622379 KEYWORDS EST. SOURCE Sinotaia aeruginosa ORGANISM Sinotaia aeruginosa Eukaryota; Metazoa; Spiralia; Lophotrochozoa; Mollusca; Gastropoda; Caenogastropoda; Architaenioglossa; Viviparoidea; Viviparidae; Sinotaia. REFERENCE 1 (bases 1 to 875) AUTHORS An,L.H. and Zheng,B.H. TITLE Construction and Characterization of Normalized cDNA Library from the Snail Bellamya aeruginosa Exposure to Copper JOURNAL Unpublished COMMENT Contact: An L.H. State Environmental Protection Key Laboratory Of Estuarine And Coastal Research Chinese Research Academy For Environment Sciences 8 Dayangfang BeiYuan Road, Chaoyang District, Beijing 100012, China Tel: +86-10-84913914 Fax: +86-10-84913914 Email: anlh@craes.org.cn PCR PRimers FORWARD: CTCGGGAAGCGCGCCATTGTGTTGGT BACKWARD: ATACGTCTCACTATAGGGCGAATTGGCC. FEATURES Location/Qualifiers source 1..875 /organism="Sinotaia aeruginosa" /mol_type="mRNA" /db_xref="taxon:2653872" /tissue_type="gonads; digestive gland; peripheral tissue" /clone_lib="SAMN00622379 Bellamya aeruginosa normalized cDNA library" /dev_stage="mature" /note="Vector: Lambda TripEx2; 1.5 microliter RNA solution (1-3 microgram of total RNA) was normalized using CDS and SMART Oligo IV primer firstly, and then the reaction solution was reversed transcription for synthesizing the first-strand using MMLV reverse transcriptase (Promega, USA). Subsequently, PCR reaction was operated and cDNA was extracted using Promegas PCR clean-up system kit (Madison, USA). And then the cDNA library was constructed using SMART cDNA Library Construction Kit. After that, 6000 random clones were sequenced by the ABI3730xl. BLAST homology searches in the nr and nt databases in GenBank were performed for each of the unigenes under Evalues of 1e-5. The unigenes were named after the homologous sequences in GenBank. The annotated unigenes were then matched to specific processes or functions using COG and GO tools." BASE COUNT 224 a 173 c 254 g 224 t ORIGIN 1 tggagtgtaa gaattacaac aagcttggaa caggatatgg tcattacaca ggaacagacg 61 caggtgttat ttgcggagat cacgttaagt catcctttcc tgtacgcctt gttaacggat 121 ctagtccgtg ggaaggtcgc gttgaattgc agtcgaatgg tcagtggggc acgatatatt 181 acagcggctg ggatgctgat gacgcaagag ttatctgccg tatgctaggt ttcaacagtt 241 atgcaatccc cgtaacttca aaccagtttg gagtgggtac aggcccggtt tatctgtatg 301 gtatgcgatg tgatgggacg gagaaacata ttcttgaatg ccccagtaac gaccaatttg 361 gagttggcag ctatggtcgt agtattgatg ccggtgtcat ctgtggtaac gggactcttt 421 caaactatcc agttcgtctt gtaaacgggt caggaccctg ggagggacga gttgagattc 481 aagcctttgg acattgggga acggtgtcct catccaactg ggacactaat gaagctagag 541 ttgtttgtca tatgctgggt tataatagtt acgcaacagc ccttacagtg gcagcaaacc 601 atttcggtag cgggacgggt ccagtctggc tgaacaatat ccagtgtgat ggaacagaga 661 cccatctgct tgagtgcccg agtactaata tgatgaattc tggcggcggg acagtgaccc 721 attcctcaga cgctggtgtc gtatgtggga acggaagtct ctctatgtac cccgttagat 781 tagtgaacgg aaattcgaca cgagaaggac ggatagaagt acaagtgaac ggggtatggg 841 gcacggtgtg tgacgacaac tgggactcta atgat //