LOCUS       JK034167                 792 bp    mRNA    linear   EST 07-FEB-2014
DEFINITION  85 (LHA-2011) Bellamya aeruginosa normalized cDNA library Bellamya
            aeruginosa cDNA 5', mRNA sequence.
ACCESSION   JK034167
VERSION     JK034167.1
DBLINK      BioSample: SAMN00622379
KEYWORDS    EST.
SOURCE      Sinotaia aeruginosa
  ORGANISM  Sinotaia aeruginosa
            Eukaryota; Metazoa; Spiralia; Lophotrochozoa; Mollusca; Gastropoda;
            Caenogastropoda; Architaenioglossa; Viviparoidea; Viviparidae;
            Sinotaia.
REFERENCE   1  (bases 1 to 792)
  AUTHORS   An,L.H. and Zheng,B.H.
  TITLE     Construction and Characterization of Normalized cDNA Library from
            the Snail Bellamya aeruginosa Exposure to Copper
  JOURNAL   Unpublished
COMMENT     Contact: An L.H.
            State Environmental Protection Key Laboratory Of Estuarine And
            Coastal Research
            Chinese Research Academy For Environment Sciences
            8 Dayangfang BeiYuan Road, Chaoyang District, Beijing 100012, China
            Tel: +86-10-84913914
            Fax: +86-10-84913914
            Email: anlh@craes.org.cn
            PCR PRimers
            FORWARD: CTCGGGAAGCGCGCCATTGTGTTGGT
            BACKWARD: ATACGTCTCACTATAGGGCGAATTGGCC.
FEATURES             Location/Qualifiers
     source          1..792
                     /organism="Sinotaia aeruginosa"
                     /mol_type="mRNA"
                     /db_xref="taxon:2653872"
                     /tissue_type="gonads; digestive gland; peripheral tissue"
                     /clone_lib="SAMN00622379 Bellamya aeruginosa normalized
                     cDNA library"
                     /dev_stage="mature"
                     /note="Vector: Lambda TripEx2; 1.5 microliter RNA solution
                     (1-3 microgram of total RNA) was normalized using CDS and
                     SMART Oligo IV primer firstly, and then the reaction
                     solution was reversed transcription for synthesizing the
                     first-strand using MMLV reverse transcriptase (Promega,
                     USA). Subsequently, PCR reaction was operated and cDNA was
                     extracted using Promegas PCR clean-up system kit (Madison,
                     USA). And then the cDNA library was constructed using
                     SMART cDNA Library Construction Kit. After that, 6000
                     random clones were sequenced by the ABI3730xl. BLAST
                     homology searches in the nr and nt databases in GenBank
                     were performed for each of the unigenes under Evalues of
                     1e-5. The unigenes were named after the homologous
                     sequences in GenBank. The annotated unigenes were then
                     matched to specific processes or functions using COG and
                     GO tools."
BASE COUNT          218 a          174 c          183 g          217 t
ORIGIN      
        1 atttgatgtg tgagagctct aaataggtgt tctagaaggt cgttgtgtct ttcattcact
       61 gcttttatca ctacgcactc gtaccataat taaaacttat ttttaataac ttcaaagcga
      121 agaaagaaaa tgccacgaag aggacgatca gcaccagccc ctaggccaat gtatcagcag
      181 agtcgaccag tttcaaccat gccagctcgg gcaccacaag ctccaccacc agcaccaatg
      241 caggctgctc ccaaacagcc aggacttttt gcacagatgg ccacaacagc tgctggtgtt
      301 gctgttggat ctgcagtggg gcatgtagct ggggctgcct tgttgggaga tggtcgccag
      361 ggagatgccc ctcaacctgc ccagcaacag aaccaggatc agcagtatta taacccatgt
      421 cagcgggaat tgcagcaatt ccttaactgt gctcagaatc aggctgactt gtctttgtgt
      481 gctggtttca atgaggctct acgccagtgc aagcttcaga atcgcatgca gccataatgg
      541 cactatgaat taaaggatgt cttttcaggc tacaggaatg ttttcttata gtggaatatg
      601 ggttcttgta attgatgtgt gaatgacagc agttgtagaa attaaaaaca tgggggaaaa
      661 cccaaataca ttgctccaaa tgtttgatgc tgcagatctt tactgctttt acctttatga
      721 ggattggtca ggtgccagtt ttctttaagt gaacatgaca ttctcacttg catttaataa
      781 aatacacgat gg
//