LOCUS JK034167 792 bp mRNA linear EST 07-FEB-2014 DEFINITION 85 (LHA-2011) Bellamya aeruginosa normalized cDNA library Bellamya aeruginosa cDNA 5', mRNA sequence. ACCESSION JK034167 VERSION JK034167.1 DBLINK BioSample: SAMN00622379 KEYWORDS EST. SOURCE Sinotaia aeruginosa ORGANISM Sinotaia aeruginosa Eukaryota; Metazoa; Spiralia; Lophotrochozoa; Mollusca; Gastropoda; Caenogastropoda; Architaenioglossa; Viviparoidea; Viviparidae; Sinotaia. REFERENCE 1 (bases 1 to 792) AUTHORS An,L.H. and Zheng,B.H. TITLE Construction and Characterization of Normalized cDNA Library from the Snail Bellamya aeruginosa Exposure to Copper JOURNAL Unpublished COMMENT Contact: An L.H. State Environmental Protection Key Laboratory Of Estuarine And Coastal Research Chinese Research Academy For Environment Sciences 8 Dayangfang BeiYuan Road, Chaoyang District, Beijing 100012, China Tel: +86-10-84913914 Fax: +86-10-84913914 Email: anlh@craes.org.cn PCR PRimers FORWARD: CTCGGGAAGCGCGCCATTGTGTTGGT BACKWARD: ATACGTCTCACTATAGGGCGAATTGGCC. FEATURES Location/Qualifiers source 1..792 /organism="Sinotaia aeruginosa" /mol_type="mRNA" /db_xref="taxon:2653872" /tissue_type="gonads; digestive gland; peripheral tissue" /clone_lib="SAMN00622379 Bellamya aeruginosa normalized cDNA library" /dev_stage="mature" /note="Vector: Lambda TripEx2; 1.5 microliter RNA solution (1-3 microgram of total RNA) was normalized using CDS and SMART Oligo IV primer firstly, and then the reaction solution was reversed transcription for synthesizing the first-strand using MMLV reverse transcriptase (Promega, USA). Subsequently, PCR reaction was operated and cDNA was extracted using Promegas PCR clean-up system kit (Madison, USA). And then the cDNA library was constructed using SMART cDNA Library Construction Kit. After that, 6000 random clones were sequenced by the ABI3730xl. BLAST homology searches in the nr and nt databases in GenBank were performed for each of the unigenes under Evalues of 1e-5. The unigenes were named after the homologous sequences in GenBank. The annotated unigenes were then matched to specific processes or functions using COG and GO tools." BASE COUNT 218 a 174 c 183 g 217 t ORIGIN 1 atttgatgtg tgagagctct aaataggtgt tctagaaggt cgttgtgtct ttcattcact 61 gcttttatca ctacgcactc gtaccataat taaaacttat ttttaataac ttcaaagcga 121 agaaagaaaa tgccacgaag aggacgatca gcaccagccc ctaggccaat gtatcagcag 181 agtcgaccag tttcaaccat gccagctcgg gcaccacaag ctccaccacc agcaccaatg 241 caggctgctc ccaaacagcc aggacttttt gcacagatgg ccacaacagc tgctggtgtt 301 gctgttggat ctgcagtggg gcatgtagct ggggctgcct tgttgggaga tggtcgccag 361 ggagatgccc ctcaacctgc ccagcaacag aaccaggatc agcagtatta taacccatgt 421 cagcgggaat tgcagcaatt ccttaactgt gctcagaatc aggctgactt gtctttgtgt 481 gctggtttca atgaggctct acgccagtgc aagcttcaga atcgcatgca gccataatgg 541 cactatgaat taaaggatgt cttttcaggc tacaggaatg ttttcttata gtggaatatg 601 ggttcttgta attgatgtgt gaatgacagc agttgtagaa attaaaaaca tgggggaaaa 661 cccaaataca ttgctccaaa tgtttgatgc tgcagatctt tactgctttt acctttatga 721 ggattggtca ggtgccagtt ttctttaagt gaacatgaca ttctcacttg catttaataa 781 aatacacgat gg //