LOCUS JK034153 788 bp mRNA linear EST 07-FEB-2014 DEFINITION 71 (LHA-2011) Bellamya aeruginosa normalized cDNA library Bellamya aeruginosa cDNA 5', mRNA sequence. ACCESSION JK034153 VERSION JK034153.1 DBLINK BioSample: SAMN00622379 KEYWORDS EST. SOURCE Sinotaia aeruginosa ORGANISM Sinotaia aeruginosa Eukaryota; Metazoa; Spiralia; Lophotrochozoa; Mollusca; Gastropoda; Caenogastropoda; Architaenioglossa; Viviparoidea; Viviparidae; Sinotaia. REFERENCE 1 (bases 1 to 788) AUTHORS An,L.H. and Zheng,B.H. TITLE Construction and Characterization of Normalized cDNA Library from the Snail Bellamya aeruginosa Exposure to Copper JOURNAL Unpublished COMMENT Contact: An L.H. State Environmental Protection Key Laboratory Of Estuarine And Coastal Research Chinese Research Academy For Environment Sciences 8 Dayangfang BeiYuan Road, Chaoyang District, Beijing 100012, China Tel: +86-10-84913914 Fax: +86-10-84913914 Email: anlh@craes.org.cn PCR PRimers FORWARD: CTCGGGAAGCGCGCCATTGTGTTGGT BACKWARD: ATACGTCTCACTATAGGGCGAATTGGCC. FEATURES Location/Qualifiers source 1..788 /organism="Sinotaia aeruginosa" /mol_type="mRNA" /db_xref="taxon:2653872" /tissue_type="gonads; digestive gland; peripheral tissue" /clone_lib="SAMN00622379 Bellamya aeruginosa normalized cDNA library" /dev_stage="mature" /note="Vector: Lambda TripEx2; 1.5 microliter RNA solution (1-3 microgram of total RNA) was normalized using CDS and SMART Oligo IV primer firstly, and then the reaction solution was reversed transcription for synthesizing the first-strand using MMLV reverse transcriptase (Promega, USA). Subsequently, PCR reaction was operated and cDNA was extracted using Promegas PCR clean-up system kit (Madison, USA). And then the cDNA library was constructed using SMART cDNA Library Construction Kit. After that, 6000 random clones were sequenced by the ABI3730xl. BLAST homology searches in the nr and nt databases in GenBank were performed for each of the unigenes under Evalues of 1e-5. The unigenes were named after the homologous sequences in GenBank. The annotated unigenes were then matched to specific processes or functions using COG and GO tools." BASE COUNT 253 a 161 c 177 g 197 t ORIGIN 1 gaacagaaaa caaatctcct ttggcactgc acttcaaagc gaaatggact ttaaactaca 61 gcttgttttc cttggcgtct tcttaaccct ttgtatggga gaaattgttg aggaaggtga 121 gattactgac gagaacggag aagttattcc agttgcccag gaaatgagtg atgactgcag 181 ctatcgtagg tacacctcgg tattcgggaa caacatccat gtcattgttg atgacatcag 241 taatggcatc agtctaataa ttctgagtga aaaccccgac gtctgctatg tccggactct 301 gacggcagaa gaaaaggcca aggatggaaa gtgtgacaat ggaactttat tagcaaagga 361 agcggaaccc tcacaagaga agaaacagtt cagtataggg gaagaaatag attttggaac 421 actgccaagt agggcccaag aactatgtca aggtcgcaaa gcactcgccc taaaagatct 481 gtccgaagac cagcctcaag atgttccaaa agagaagcgc acgtgcagaa ttaccgtgaa 541 gatcgaaact aaaaaagtct gccgacctgt ctgccgtaga aagcgttttc gtatacgatg 601 caaaatcgaa tgcaaaaaaa ttaagattgt tcttaaggta ccaccattct gttagagaca 661 agtaacaccc caggcatttg gaacgcagcc agatatttaa aatctaacat cctctctccg 721 ctgtcttcac acatttctgt caagaatgta tttggcatgc tgatttgcag tgggtttatt 781 tttattta //