LOCUS JK034146 893 bp mRNA linear EST 07-FEB-2014 DEFINITION 64 (LHA-2011) Bellamya aeruginosa normalized cDNA library Bellamya aeruginosa cDNA 5', mRNA sequence. ACCESSION JK034146 VERSION JK034146.1 DBLINK BioSample: SAMN00622379 KEYWORDS EST. SOURCE Sinotaia aeruginosa ORGANISM Sinotaia aeruginosa Eukaryota; Metazoa; Spiralia; Lophotrochozoa; Mollusca; Gastropoda; Caenogastropoda; Architaenioglossa; Viviparoidea; Viviparidae; Sinotaia. REFERENCE 1 (bases 1 to 893) AUTHORS An,L.H. and Zheng,B.H. TITLE Construction and Characterization of Normalized cDNA Library from the Snail Bellamya aeruginosa Exposure to Copper JOURNAL Unpublished COMMENT Contact: An L.H. State Environmental Protection Key Laboratory Of Estuarine And Coastal Research Chinese Research Academy For Environment Sciences 8 Dayangfang BeiYuan Road, Chaoyang District, Beijing 100012, China Tel: +86-10-84913914 Fax: +86-10-84913914 Email: anlh@craes.org.cn PCR PRimers FORWARD: CTCGGGAAGCGCGCCATTGTGTTGGT BACKWARD: ATACGTCTCACTATAGGGCGAATTGGCC. FEATURES Location/Qualifiers source 1..893 /organism="Sinotaia aeruginosa" /mol_type="mRNA" /db_xref="taxon:2653872" /tissue_type="gonads; digestive gland; peripheral tissue" /clone_lib="SAMN00622379 Bellamya aeruginosa normalized cDNA library" /dev_stage="mature" /note="Vector: Lambda TripEx2; 1.5 microliter RNA solution (1-3 microgram of total RNA) was normalized using CDS and SMART Oligo IV primer firstly, and then the reaction solution was reversed transcription for synthesizing the first-strand using MMLV reverse transcriptase (Promega, USA). Subsequently, PCR reaction was operated and cDNA was extracted using Promegas PCR clean-up system kit (Madison, USA). And then the cDNA library was constructed using SMART cDNA Library Construction Kit. After that, 6000 random clones were sequenced by the ABI3730xl. BLAST homology searches in the nr and nt databases in GenBank were performed for each of the unigenes under Evalues of 1e-5. The unigenes were named after the homologous sequences in GenBank. The annotated unigenes were then matched to specific processes or functions using COG and GO tools." BASE COUNT 255 a 200 c 217 g 221 t ORIGIN 1 gttaattata ttgcaaacac tggcatgtga aggtgcaggt atatactaaa gttaacaagt 61 ctgcggagaa gaggtgtacc tgttgctgta accactgttg gcgtcacaca acagacacaa 121 cagatcagta gacatggtca acaggtggat gtggattttg atggttatca ttttccattg 181 ctgcaagtat gtctgctctc gagctttaca ggaatcaatg attaacccag aagaaaacat 241 cggcgtgaat gaatatttat cagaaggaga cattagaatt tcacggcgaa ggaatgcggt 301 tcgagacttt tctcaaacgt gggttaaccg cactgtgcct tacaccgtgg agaaacttag 361 tgatacagaa catcagcaag ttgtcatggc tatgcgagag ttatctgcca aatcctgcgt 421 ccgttttgta ccgcgtacca ttcaaaggga ttatatcact atagtcaaac tcgatggttg 481 cagcagttcc gtgggaaggc gtggtggaca gcaacaagtc atccttggag acggttgcta 541 cgagaaaggc accattatgc acgagctaat gcacgcgctt ggattctggc acgagcacag 601 ccgccctgat cgtgacgact tcatccagat tatctggagc aatattgcac aggagcacaa 661 gtccaatttt gaaagatatg accaatcagc tatcgacacg ctcaacactg tttacgacta 721 cggttccatc atgcattaca agaacgacac gtttgccatg gaccggagca agatcacaat 781 taacgccacc ttaccgctgc ccccaggggt ggagatgggt cagcgggtca tgctatccga 841 cacagatatt gtgaggctct cacggctgta cagatgtaac attactcatt gct //