LOCUS       JK034139                 873 bp    mRNA    linear   EST 07-FEB-2014
DEFINITION  57 (LHA-2011) Bellamya aeruginosa normalized cDNA library Bellamya
            aeruginosa cDNA 5', mRNA sequence.
ACCESSION   JK034139
VERSION     JK034139.1
DBLINK      BioSample: SAMN00622379
KEYWORDS    EST.
SOURCE      Sinotaia aeruginosa
  ORGANISM  Sinotaia aeruginosa
            Eukaryota; Metazoa; Spiralia; Lophotrochozoa; Mollusca; Gastropoda;
            Caenogastropoda; Architaenioglossa; Viviparoidea; Viviparidae;
            Sinotaia.
REFERENCE   1  (bases 1 to 873)
  AUTHORS   An,L.H. and Zheng,B.H.
  TITLE     Construction and Characterization of Normalized cDNA Library from
            the Snail Bellamya aeruginosa Exposure to Copper
  JOURNAL   Unpublished
COMMENT     Contact: An L.H.
            State Environmental Protection Key Laboratory Of Estuarine And
            Coastal Research
            Chinese Research Academy For Environment Sciences
            8 Dayangfang BeiYuan Road, Chaoyang District, Beijing 100012, China
            Tel: +86-10-84913914
            Fax: +86-10-84913914
            Email: anlh@craes.org.cn
            PCR PRimers
            FORWARD: CTCGGGAAGCGCGCCATTGTGTTGGT
            BACKWARD: ATACGTCTCACTATAGGGCGAATTGGCC.
FEATURES             Location/Qualifiers
     source          1..873
                     /organism="Sinotaia aeruginosa"
                     /mol_type="mRNA"
                     /db_xref="taxon:2653872"
                     /tissue_type="gonads; digestive gland; peripheral tissue"
                     /clone_lib="SAMN00622379 Bellamya aeruginosa normalized
                     cDNA library"
                     /dev_stage="mature"
                     /note="Vector: Lambda TripEx2; 1.5 microliter RNA solution
                     (1-3 microgram of total RNA) was normalized using CDS and
                     SMART Oligo IV primer firstly, and then the reaction
                     solution was reversed transcription for synthesizing the
                     first-strand using MMLV reverse transcriptase (Promega,
                     USA). Subsequently, PCR reaction was operated and cDNA was
                     extracted using Promegas PCR clean-up system kit (Madison,
                     USA). And then the cDNA library was constructed using
                     SMART cDNA Library Construction Kit. After that, 6000
                     random clones were sequenced by the ABI3730xl. BLAST
                     homology searches in the nr and nt databases in GenBank
                     were performed for each of the unigenes under Evalues of
                     1e-5. The unigenes were named after the homologous
                     sequences in GenBank. The annotated unigenes were then
                     matched to specific processes or functions using COG and
                     GO tools."
BASE COUNT          326 a          151 c          191 g          205 t
ORIGIN      
        1 tgcttctgtt gaaagctgcc cactgttgca aaacacaagc agacgatttc agaagagaat
       61 tccaagtcaa atgcgttgag atagttattc ggtataaatc atcaaagtcc agtcactgca
      121 tgctggcaat aatgaatgct gctgctgata acacaagtgt aacagagtct gtaccaaacc
      181 aagatgacaa tcagaacagt tcagccaatg gtgaagatac aacaaagaaa gagaatgaag
      241 aacaaaacaa agttctaact gccgctgcta atggtgatgt ttcaccaagt gaaggtgata
      301 aaaaacaagg tgcatctcaa gacaataatg ccagtactgt cttgattgaa gatgcacagg
      361 ggagagagat ggaagggcag attgcaactc cggagagtgt tgccaacagt aaagagtcac
      421 cagaagaaca aaatgtcaag aaagatgcca cagtagaatg tgacgttaga gccagtgata
      481 aagacagttt atataatgtg gaaccaacaa gtgataatgc atttcgaatg ggaacagaag
      541 tttgtgtgga tcctgctatc atcagccaga ttagtaatgc ttttgttcaa cgaatccttc
      601 ctactttaga aaaatcaaaa gcatctatca aagatgtatt atcaaaccag attgtgttga
      661 ttgaaacttt ggaacaagag aattgcaaat tcaaagactg tgcagaatat tttgagctct
      721 ctgatacaat ggtgaaagct aaagagtatt gcaataaatt gcacactatc aagaaggaca
      781 tgacgaactt acatgaaaga gctgcaaaat taaagaggcg ggcacttaag cttcagcagc
      841 aaaaacataa agaggaattt catcgtgctc gtc
//