LOCUS JK034139 873 bp mRNA linear EST 07-FEB-2014 DEFINITION 57 (LHA-2011) Bellamya aeruginosa normalized cDNA library Bellamya aeruginosa cDNA 5', mRNA sequence. ACCESSION JK034139 VERSION JK034139.1 DBLINK BioSample: SAMN00622379 KEYWORDS EST. SOURCE Sinotaia aeruginosa ORGANISM Sinotaia aeruginosa Eukaryota; Metazoa; Spiralia; Lophotrochozoa; Mollusca; Gastropoda; Caenogastropoda; Architaenioglossa; Viviparoidea; Viviparidae; Sinotaia. REFERENCE 1 (bases 1 to 873) AUTHORS An,L.H. and Zheng,B.H. TITLE Construction and Characterization of Normalized cDNA Library from the Snail Bellamya aeruginosa Exposure to Copper JOURNAL Unpublished COMMENT Contact: An L.H. State Environmental Protection Key Laboratory Of Estuarine And Coastal Research Chinese Research Academy For Environment Sciences 8 Dayangfang BeiYuan Road, Chaoyang District, Beijing 100012, China Tel: +86-10-84913914 Fax: +86-10-84913914 Email: anlh@craes.org.cn PCR PRimers FORWARD: CTCGGGAAGCGCGCCATTGTGTTGGT BACKWARD: ATACGTCTCACTATAGGGCGAATTGGCC. FEATURES Location/Qualifiers source 1..873 /organism="Sinotaia aeruginosa" /mol_type="mRNA" /db_xref="taxon:2653872" /tissue_type="gonads; digestive gland; peripheral tissue" /clone_lib="SAMN00622379 Bellamya aeruginosa normalized cDNA library" /dev_stage="mature" /note="Vector: Lambda TripEx2; 1.5 microliter RNA solution (1-3 microgram of total RNA) was normalized using CDS and SMART Oligo IV primer firstly, and then the reaction solution was reversed transcription for synthesizing the first-strand using MMLV reverse transcriptase (Promega, USA). Subsequently, PCR reaction was operated and cDNA was extracted using Promegas PCR clean-up system kit (Madison, USA). And then the cDNA library was constructed using SMART cDNA Library Construction Kit. After that, 6000 random clones were sequenced by the ABI3730xl. BLAST homology searches in the nr and nt databases in GenBank were performed for each of the unigenes under Evalues of 1e-5. The unigenes were named after the homologous sequences in GenBank. The annotated unigenes were then matched to specific processes or functions using COG and GO tools." BASE COUNT 326 a 151 c 191 g 205 t ORIGIN 1 tgcttctgtt gaaagctgcc cactgttgca aaacacaagc agacgatttc agaagagaat 61 tccaagtcaa atgcgttgag atagttattc ggtataaatc atcaaagtcc agtcactgca 121 tgctggcaat aatgaatgct gctgctgata acacaagtgt aacagagtct gtaccaaacc 181 aagatgacaa tcagaacagt tcagccaatg gtgaagatac aacaaagaaa gagaatgaag 241 aacaaaacaa agttctaact gccgctgcta atggtgatgt ttcaccaagt gaaggtgata 301 aaaaacaagg tgcatctcaa gacaataatg ccagtactgt cttgattgaa gatgcacagg 361 ggagagagat ggaagggcag attgcaactc cggagagtgt tgccaacagt aaagagtcac 421 cagaagaaca aaatgtcaag aaagatgcca cagtagaatg tgacgttaga gccagtgata 481 aagacagttt atataatgtg gaaccaacaa gtgataatgc atttcgaatg ggaacagaag 541 tttgtgtgga tcctgctatc atcagccaga ttagtaatgc ttttgttcaa cgaatccttc 601 ctactttaga aaaatcaaaa gcatctatca aagatgtatt atcaaaccag attgtgttga 661 ttgaaacttt ggaacaagag aattgcaaat tcaaagactg tgcagaatat tttgagctct 721 ctgatacaat ggtgaaagct aaagagtatt gcaataaatt gcacactatc aagaaggaca 781 tgacgaactt acatgaaaga gctgcaaaat taaagaggcg ggcacttaag cttcagcagc 841 aaaaacataa agaggaattt catcgtgctc gtc //