LOCUS JK034132 919 bp mRNA linear EST 07-FEB-2014 DEFINITION 50 (LHA-2011) Bellamya aeruginosa normalized cDNA library Bellamya aeruginosa cDNA 5', mRNA sequence. ACCESSION JK034132 VERSION JK034132.1 DBLINK BioSample: SAMN00622379 KEYWORDS EST. SOURCE Sinotaia aeruginosa ORGANISM Sinotaia aeruginosa Eukaryota; Metazoa; Spiralia; Lophotrochozoa; Mollusca; Gastropoda; Caenogastropoda; Architaenioglossa; Viviparoidea; Viviparidae; Sinotaia. REFERENCE 1 (bases 1 to 919) AUTHORS An,L.H. and Zheng,B.H. TITLE Construction and Characterization of Normalized cDNA Library from the Snail Bellamya aeruginosa Exposure to Copper JOURNAL Unpublished COMMENT Contact: An L.H. State Environmental Protection Key Laboratory Of Estuarine And Coastal Research Chinese Research Academy For Environment Sciences 8 Dayangfang BeiYuan Road, Chaoyang District, Beijing 100012, China Tel: +86-10-84913914 Fax: +86-10-84913914 Email: anlh@craes.org.cn PCR PRimers FORWARD: CTCGGGAAGCGCGCCATTGTGTTGGT BACKWARD: ATACGTCTCACTATAGGGCGAATTGGCC. FEATURES Location/Qualifiers source 1..919 /organism="Sinotaia aeruginosa" /mol_type="mRNA" /db_xref="taxon:2653872" /tissue_type="gonads; digestive gland; peripheral tissue" /clone_lib="SAMN00622379 Bellamya aeruginosa normalized cDNA library" /dev_stage="mature" /note="Vector: Lambda TripEx2; 1.5 microliter RNA solution (1-3 microgram of total RNA) was normalized using CDS and SMART Oligo IV primer firstly, and then the reaction solution was reversed transcription for synthesizing the first-strand using MMLV reverse transcriptase (Promega, USA). Subsequently, PCR reaction was operated and cDNA was extracted using Promegas PCR clean-up system kit (Madison, USA). And then the cDNA library was constructed using SMART cDNA Library Construction Kit. After that, 6000 random clones were sequenced by the ABI3730xl. BLAST homology searches in the nr and nt databases in GenBank were performed for each of the unigenes under Evalues of 1e-5. The unigenes were named after the homologous sequences in GenBank. The annotated unigenes were then matched to specific processes or functions using COG and GO tools." BASE COUNT 287 a 214 c 209 g 209 t ORIGIN 1 ggtccgcacc gaaaagatgg cgtgtgcttt tctttgttag aaactgtcca tatttttgat 61 attttatgga caacatatag ttgctttgct gattgcagaa gttgtgattc agtgcattaa 121 gtagtatttc tgacaaccaa gatacttcag acatggctct tcccaacttt cgtgcccaaa 181 catctccagt accacagaga gctcgcaata ctccaggtac acctcagaca tcagaaaagg 241 ctgagaaatc aagtggaagc ccatttgttc agtcaccaca tggtcatcct ggctttaacc 301 caaccaaatc ccgtgttaaa gtctcaggat catcagagag attgcccaaa ccgcccaaac 361 ctcctgacaa gcccttgatg ccgtatatga gatacagcag aaagtttcaa agcatggtgc 421 atacatatca gaaggtttgg gagcaggtga aggcccaaaa cccagatctc aagctgtggg 481 agatcggcaa gatcataggg cagatgtggc gcgacctatc agaaacagaa aaacaggagt 541 acacagagga gtatgagaca gagaaggcaa cttacaatga gtcaatgaag gtttaccaca 601 actcaccagc ttatcaggct tgggtagctg ccaaaggtaa agctgaaagg gaaagagaag 661 cagctgctgc tgtagaggaa gataagccac ctgctcggcc tgacagaacc acaacatcgt 721 cccggcagtc acaaagtcaa aaacttgaga tgccacgaat cagcattcag ccagcagaag 781 atgatgatga tccagatgat ggattttcag taaaacatat tgcccatgct cgctacattc 841 gtaaccaccg cctgattaat gagattttta gtgacagcgt tgtacctgat gtccgcacag 901 tcgtcactac tggacgcat //