LOCUS JK034118 924 bp mRNA linear EST 07-FEB-2014 DEFINITION 36 (LHA-2011) Bellamya aeruginosa normalized cDNA library Bellamya aeruginosa cDNA 5', mRNA sequence. ACCESSION JK034118 VERSION JK034118.1 DBLINK BioSample: SAMN00622379 KEYWORDS EST. SOURCE Sinotaia aeruginosa ORGANISM Sinotaia aeruginosa Eukaryota; Metazoa; Spiralia; Lophotrochozoa; Mollusca; Gastropoda; Caenogastropoda; Architaenioglossa; Viviparoidea; Viviparidae; Sinotaia. REFERENCE 1 (bases 1 to 924) AUTHORS An,L.H. and Zheng,B.H. TITLE Construction and Characterization of Normalized cDNA Library from the Snail Bellamya aeruginosa Exposure to Copper JOURNAL Unpublished COMMENT Contact: An L.H. State Environmental Protection Key Laboratory Of Estuarine And Coastal Research Chinese Research Academy For Environment Sciences 8 Dayangfang BeiYuan Road, Chaoyang District, Beijing 100012, China Tel: +86-10-84913914 Fax: +86-10-84913914 Email: anlh@craes.org.cn PCR PRimers FORWARD: CTCGGGAAGCGCGCCATTGTGTTGGT BACKWARD: ATACGTCTCACTATAGGGCGAATTGGCC. FEATURES Location/Qualifiers source 1..924 /organism="Sinotaia aeruginosa" /mol_type="mRNA" /db_xref="taxon:2653872" /tissue_type="gonads; digestive gland; peripheral tissue" /clone_lib="SAMN00622379 Bellamya aeruginosa normalized cDNA library" /dev_stage="mature" /note="Vector: Lambda TripEx2; 1.5 microliter RNA solution (1-3 microgram of total RNA) was normalized using CDS and SMART Oligo IV primer firstly, and then the reaction solution was reversed transcription for synthesizing the first-strand using MMLV reverse transcriptase (Promega, USA). Subsequently, PCR reaction was operated and cDNA was extracted using Promegas PCR clean-up system kit (Madison, USA). And then the cDNA library was constructed using SMART cDNA Library Construction Kit. After that, 6000 random clones were sequenced by the ABI3730xl. BLAST homology searches in the nr and nt databases in GenBank were performed for each of the unigenes under Evalues of 1e-5. The unigenes were named after the homologous sequences in GenBank. The annotated unigenes were then matched to specific processes or functions using COG and GO tools." BASE COUNT 290 a 175 c 189 g 269 t ORIGIN 1 acgtaccttc ttggtttgtt tacaattcaa tctgtcaata gggacttaat taattggtct 61 agccattcac gatcattttg ctgctgcaat cacttaatta attattagtt caatctttca 121 cagacattgt atagactaca gtgtggtgaa tgaggggagt acaattttaa tacgtattag 181 gttgccgata aatatttctg gcaaaagcag ttgtatagaa gtgaggaatt cggaaagaat 241 tgttccattt ctgcgagcta gcacacgaag agatcagttc ccgatattaa aaatcctatt 301 gagtcgcaga cttgtagttc tcacctggaa taaaaggaag ttctgctagt aacagtgcag 361 tgcagtctaa ttctcacgtg acatacgtgc aaagtgcagg acaaaacaga ccgttgagta 421 tttcgcactt agcagatatt gggttggttc aacgaaaaat ttgaactctc cgctaacaat 481 gcacaaacaa cttattgtct gggccgccat tttcataact tgtatgaatg ctgatgttgt 541 tcatacaacc gacactacat cgccctcatc tcaagtaaac gtcactatga cgtcatttag 601 tcatggaaaa atctctggcg aaaaacgacg aattcccatg agagaaggaa gaatttatgg 661 aggtaccgaa attaaaccat attcatggcc tttcatggta caattgtatg cttacagtca 721 taatcgcacg tatttgtgtg gnggcattgt ttacaatgag agttacgtca taactgcagc 781 gcactgtgta acgagtgata cgccatatgt gaatgtgact gcaggtaaac attcactctt 841 tgcaagagaa agtcaagaac aaattcgaac tgtatcaagg atcgtgaaac acccgggatt 901 caatgttcat acagatcatg acat //