LOCUS JK034111 887 bp mRNA linear EST 07-FEB-2014 DEFINITION 29 (LHA-2011) Bellamya aeruginosa normalized cDNA library Bellamya aeruginosa cDNA 5', mRNA sequence. ACCESSION JK034111 VERSION JK034111.1 DBLINK BioSample: SAMN00622379 KEYWORDS EST. SOURCE Sinotaia aeruginosa ORGANISM Sinotaia aeruginosa Eukaryota; Metazoa; Spiralia; Lophotrochozoa; Mollusca; Gastropoda; Caenogastropoda; Architaenioglossa; Viviparoidea; Viviparidae; Sinotaia. REFERENCE 1 (bases 1 to 887) AUTHORS An,L.H. and Zheng,B.H. TITLE Construction and Characterization of Normalized cDNA Library from the Snail Bellamya aeruginosa Exposure to Copper JOURNAL Unpublished COMMENT Contact: An L.H. State Environmental Protection Key Laboratory Of Estuarine And Coastal Research Chinese Research Academy For Environment Sciences 8 Dayangfang BeiYuan Road, Chaoyang District, Beijing 100012, China Tel: +86-10-84913914 Fax: +86-10-84913914 Email: anlh@craes.org.cn PCR PRimers FORWARD: CTCGGGAAGCGCGCCATTGTGTTGGT BACKWARD: ATACGTCTCACTATAGGGCGAATTGGCC. FEATURES Location/Qualifiers source 1..887 /organism="Sinotaia aeruginosa" /mol_type="mRNA" /db_xref="taxon:2653872" /tissue_type="gonads; digestive gland; peripheral tissue" /clone_lib="SAMN00622379 Bellamya aeruginosa normalized cDNA library" /dev_stage="mature" /note="Vector: Lambda TripEx2; 1.5 microliter RNA solution (1-3 microgram of total RNA) was normalized using CDS and SMART Oligo IV primer firstly, and then the reaction solution was reversed transcription for synthesizing the first-strand using MMLV reverse transcriptase (Promega, USA). Subsequently, PCR reaction was operated and cDNA was extracted using Promegas PCR clean-up system kit (Madison, USA). And then the cDNA library was constructed using SMART cDNA Library Construction Kit. After that, 6000 random clones were sequenced by the ABI3730xl. BLAST homology searches in the nr and nt databases in GenBank were performed for each of the unigenes under Evalues of 1e-5. The unigenes were named after the homologous sequences in GenBank. The annotated unigenes were then matched to specific processes or functions using COG and GO tools." BASE COUNT 233 a 215 c 239 g 200 t ORIGIN 1 gggcatgcct gtgcataaca gctcacaagt acattaaagg tgtgccattt ctcactaact 61 ggacagataa catccaactc cgtttctaaa gtgttacagt tctgtctgcg tcggacatat 121 ttcagaggaa tgcccgcccg ctagataacc acaacagaat aatcaggagc tagcactggg 181 caactcaaac tagattgaaa atatcagaag atggctgacg ggtataaact gatggtcaag 241 cacgtcggac aaattgtaca agtcagttcc acgcgacaga aggccaaata tggccctgat 301 atgaaaaatg ttgacatttt ggagggagag acgggaggct attctctcct cgtggacagg 361 aacggcttgc tggctgacat tggtcctaca gtcgttttgg acgagaagta ccgtcaggca 421 aaaatcgatc agattctgga cgcttgcgga aagtgtgttt tacctggact tgtagacgca 481 catacacatg cagtttgggc cggagaccga gtgcatgagt ttacgatgaa gctggctgga 541 gccacttaca tggagatcca cgaggcaggg ggtggcattt atttcaccgt gaaccacacc 601 cgcagcgcca gcgatgacac actgttccac ttacttcgag tgcgtcttct gaagatgctg 661 cgctccggca cgaccttggt ggaggtcaaa agtggctatg gccttgacct tgacaacgaa 721 gtgaagatgc tacgcgtgat tgaacgtgcc cgacgagccg tacccattga catctcgtgc 781 acgtactgcg gggctcacgc cgtgcccatt ggtcagactg cccaggaggc aacacaaaac 841 gtgttacaag tgcaactgcc tcggattctg gagctgacgt cgtctgg //