LOCUS JK034104 639 bp mRNA linear EST 07-FEB-2014 DEFINITION 22 (LHA-2011) Bellamya aeruginosa normalized cDNA library Bellamya aeruginosa cDNA 5', mRNA sequence. ACCESSION JK034104 VERSION JK034104.1 DBLINK BioSample: SAMN00622379 KEYWORDS EST. SOURCE Sinotaia aeruginosa ORGANISM Sinotaia aeruginosa Eukaryota; Metazoa; Spiralia; Lophotrochozoa; Mollusca; Gastropoda; Caenogastropoda; Architaenioglossa; Viviparoidea; Viviparidae; Sinotaia. REFERENCE 1 (bases 1 to 639) AUTHORS An,L.H. and Zheng,B.H. TITLE Construction and Characterization of Normalized cDNA Library from the Snail Bellamya aeruginosa Exposure to Copper JOURNAL Unpublished COMMENT Contact: An L.H. State Environmental Protection Key Laboratory Of Estuarine And Coastal Research Chinese Research Academy For Environment Sciences 8 Dayangfang BeiYuan Road, Chaoyang District, Beijing 100012, China Tel: +86-10-84913914 Fax: +86-10-84913914 Email: anlh@craes.org.cn PCR PRimers FORWARD: CTCGGGAAGCGCGCCATTGTGTTGGT BACKWARD: ATACGTCTCACTATAGGGCGAATTGGCC. FEATURES Location/Qualifiers source 1..639 /organism="Sinotaia aeruginosa" /mol_type="mRNA" /db_xref="taxon:2653872" /tissue_type="gonads; digestive gland; peripheral tissue" /clone_lib="SAMN00622379 Bellamya aeruginosa normalized cDNA library" /dev_stage="mature" /note="Vector: Lambda TripEx2; 1.5 microliter RNA solution (1-3 microgram of total RNA) was normalized using CDS and SMART Oligo IV primer firstly, and then the reaction solution was reversed transcription for synthesizing the first-strand using MMLV reverse transcriptase (Promega, USA). Subsequently, PCR reaction was operated and cDNA was extracted using Promegas PCR clean-up system kit (Madison, USA). And then the cDNA library was constructed using SMART cDNA Library Construction Kit. After that, 6000 random clones were sequenced by the ABI3730xl. BLAST homology searches in the nr and nt databases in GenBank were performed for each of the unigenes under Evalues of 1e-5. The unigenes were named after the homologous sequences in GenBank. The annotated unigenes were then matched to specific processes or functions using COG and GO tools." BASE COUNT 210 a 142 c 135 g 152 t ORIGIN 1 gattgcacaa cgaagtcgct ggagtcagtt gtagacaaaa cttagtcgct acatcatgac 61 ttccaacact gacacagggt gttatgcact aattcgctgt cgaaaataac cagttatatc 121 tcccataact tatacatgga taacaaatgt ggatataatg cccattatct aagaaaatat 181 tacacatttc atcatgtgat gaaagtgacc aatcaaattc agcgttttta aactaaacat 241 ataaaaaggt gtatgtcgta cgaggcagtg tgggatgctg ttgaccgaag ccaatggtgt 301 atcggagaat ctagcaaaaa caatggaccc gaagagccat ccggcactgc aagggtacca 361 gcagaatgcc ccaaacgtca ttgcagggtc aaatggtgat ctgaagagtc cgtccaagat 421 gaatgacaac tctgtgtatg actttgataa ccaccagagt gaggaggatg agccacccag 481 accaccttct caggggccag gaacatcaca gcagtcacga cgtggacggc tgactaacca 541 actccaatat ttactaaaga aagtcctcta tcccttatgg aagcaccatt atgcatggcc 601 tttccatgta cctgttgatg cagagaaact taatctaaa //