LOCUS JK034090 829 bp mRNA linear EST 07-FEB-2014 DEFINITION 8 (LHA-2011) Bellamya aeruginosa normalized cDNA library Bellamya aeruginosa cDNA 5', mRNA sequence. ACCESSION JK034090 VERSION JK034090.1 DBLINK BioSample: SAMN00622379 KEYWORDS EST. SOURCE Sinotaia aeruginosa ORGANISM Sinotaia aeruginosa Eukaryota; Metazoa; Spiralia; Lophotrochozoa; Mollusca; Gastropoda; Caenogastropoda; Architaenioglossa; Viviparoidea; Viviparidae; Sinotaia. REFERENCE 1 (bases 1 to 829) AUTHORS An,L.H. and Zheng,B.H. TITLE Construction and Characterization of Normalized cDNA Library from the Snail Bellamya aeruginosa Exposure to Copper JOURNAL Unpublished COMMENT Contact: An L.H. State Environmental Protection Key Laboratory Of Estuarine And Coastal Research Chinese Research Academy For Environment Sciences 8 Dayangfang BeiYuan Road, Chaoyang District, Beijing 100012, China Tel: +86-10-84913914 Fax: +86-10-84913914 Email: anlh@craes.org.cn PCR PRimers FORWARD: CTCGGGAAGCGCGCCATTGTGTTGGT BACKWARD: ATACGTCTCACTATAGGGCGAATTGGCC. FEATURES Location/Qualifiers source 1..829 /organism="Sinotaia aeruginosa" /mol_type="mRNA" /db_xref="taxon:2653872" /tissue_type="gonads; digestive gland; peripheral tissue" /clone_lib="SAMN00622379 Bellamya aeruginosa normalized cDNA library" /dev_stage="mature" /note="Vector: Lambda TripEx2; 1.5 microliter RNA solution (1-3 microgram of total RNA) was normalized using CDS and SMART Oligo IV primer firstly, and then the reaction solution was reversed transcription for synthesizing the first-strand using MMLV reverse transcriptase (Promega, USA). Subsequently, PCR reaction was operated and cDNA was extracted using Promegas PCR clean-up system kit (Madison, USA). And then the cDNA library was constructed using SMART cDNA Library Construction Kit. After that, 6000 random clones were sequenced by the ABI3730xl. BLAST homology searches in the nr and nt databases in GenBank were performed for each of the unigenes under Evalues of 1e-5. The unigenes were named after the homologous sequences in GenBank. The annotated unigenes were then matched to specific processes or functions using COG and GO tools." BASE COUNT 245 a 212 c 195 g 177 t ORIGIN 1 ggggacaata tggcgaactc caccagcagt ccggaataaa tcagaattcg tggaagattg 61 ttacctaact acttttaaac agatcttttt ctccccatct tctttcattt tgtatgatta 121 ttttgtattg tctttgaaga acaagcaaaa tgtcaaatcc tggttatcag ggtgatggtt 181 ttcaagagag accccctgga gtcagaatga gcggtgaagg ttctggccag ataaatctag 241 atcaagaact tgcacgcaag gtggcactgc agacacagat gttggagcat gagcgccaga 301 aggaagttct aggctatcag caggcactca tgttacagga gcagcaacag gtgatgggat 361 cgattcaacc acctcctcca ccacctcaac caccacaacc tcagcagcag actgctgacc 421 tcatgctgaa agcattgcag cagcaacaga tgatcgaggc agagaagcag cgggaagctc 481 agcaaaaatt aatgcaacag caacagttgg cacttatgga agcccaaaga aacgagcagc 541 agaagcgcat gctgatggag gctcagcagc agcaacaaca gcagcatatg caccaacacc 601 ctttgcctcc catgtctgcg ggttcacaag ggtctgccca acatcaggtc tctcaacacc 661 aacagctggg acctccagga gtagctcttg tcatgtcagg acacattggt tcaggaatgc 721 agtcacaggc ccagccccat agcatgggtc caccaccttc catggttggc catcctggac 781 aaggtccacc atcacacatg atgatgaatc aagtaatggc tggatctat //