LOCUS       JK034090                 829 bp    mRNA    linear   EST 07-FEB-2014
DEFINITION  8 (LHA-2011) Bellamya aeruginosa normalized cDNA library Bellamya
            aeruginosa cDNA 5', mRNA sequence.
ACCESSION   JK034090
VERSION     JK034090.1
DBLINK      BioSample: SAMN00622379
KEYWORDS    EST.
SOURCE      Sinotaia aeruginosa
  ORGANISM  Sinotaia aeruginosa
            Eukaryota; Metazoa; Spiralia; Lophotrochozoa; Mollusca; Gastropoda;
            Caenogastropoda; Architaenioglossa; Viviparoidea; Viviparidae;
            Sinotaia.
REFERENCE   1  (bases 1 to 829)
  AUTHORS   An,L.H. and Zheng,B.H.
  TITLE     Construction and Characterization of Normalized cDNA Library from
            the Snail Bellamya aeruginosa Exposure to Copper
  JOURNAL   Unpublished
COMMENT     Contact: An L.H.
            State Environmental Protection Key Laboratory Of Estuarine And
            Coastal Research
            Chinese Research Academy For Environment Sciences
            8 Dayangfang BeiYuan Road, Chaoyang District, Beijing 100012, China
            Tel: +86-10-84913914
            Fax: +86-10-84913914
            Email: anlh@craes.org.cn
            PCR PRimers
            FORWARD: CTCGGGAAGCGCGCCATTGTGTTGGT
            BACKWARD: ATACGTCTCACTATAGGGCGAATTGGCC.
FEATURES             Location/Qualifiers
     source          1..829
                     /organism="Sinotaia aeruginosa"
                     /mol_type="mRNA"
                     /db_xref="taxon:2653872"
                     /tissue_type="gonads; digestive gland; peripheral tissue"
                     /clone_lib="SAMN00622379 Bellamya aeruginosa normalized
                     cDNA library"
                     /dev_stage="mature"
                     /note="Vector: Lambda TripEx2; 1.5 microliter RNA solution
                     (1-3 microgram of total RNA) was normalized using CDS and
                     SMART Oligo IV primer firstly, and then the reaction
                     solution was reversed transcription for synthesizing the
                     first-strand using MMLV reverse transcriptase (Promega,
                     USA). Subsequently, PCR reaction was operated and cDNA was
                     extracted using Promegas PCR clean-up system kit (Madison,
                     USA). And then the cDNA library was constructed using
                     SMART cDNA Library Construction Kit. After that, 6000
                     random clones were sequenced by the ABI3730xl. BLAST
                     homology searches in the nr and nt databases in GenBank
                     were performed for each of the unigenes under Evalues of
                     1e-5. The unigenes were named after the homologous
                     sequences in GenBank. The annotated unigenes were then
                     matched to specific processes or functions using COG and
                     GO tools."
BASE COUNT          245 a          212 c          195 g          177 t
ORIGIN      
        1 ggggacaata tggcgaactc caccagcagt ccggaataaa tcagaattcg tggaagattg
       61 ttacctaact acttttaaac agatcttttt ctccccatct tctttcattt tgtatgatta
      121 ttttgtattg tctttgaaga acaagcaaaa tgtcaaatcc tggttatcag ggtgatggtt
      181 ttcaagagag accccctgga gtcagaatga gcggtgaagg ttctggccag ataaatctag
      241 atcaagaact tgcacgcaag gtggcactgc agacacagat gttggagcat gagcgccaga
      301 aggaagttct aggctatcag caggcactca tgttacagga gcagcaacag gtgatgggat
      361 cgattcaacc acctcctcca ccacctcaac caccacaacc tcagcagcag actgctgacc
      421 tcatgctgaa agcattgcag cagcaacaga tgatcgaggc agagaagcag cgggaagctc
      481 agcaaaaatt aatgcaacag caacagttgg cacttatgga agcccaaaga aacgagcagc
      541 agaagcgcat gctgatggag gctcagcagc agcaacaaca gcagcatatg caccaacacc
      601 ctttgcctcc catgtctgcg ggttcacaag ggtctgccca acatcaggtc tctcaacacc
      661 aacagctggg acctccagga gtagctcttg tcatgtcagg acacattggt tcaggaatgc
      721 agtcacaggc ccagccccat agcatgggtc caccaccttc catggttggc catcctggac
      781 aaggtccacc atcacacatg atgatgaatc aagtaatggc tggatctat
//