LOCUS JK034083 804 bp mRNA linear EST 07-FEB-2014 DEFINITION 1 (LHA-2011) Bellamya aeruginosa normalized cDNA library Bellamya aeruginosa cDNA 5', mRNA sequence. ACCESSION JK034083 VERSION JK034083.1 DBLINK BioSample: SAMN00622379 KEYWORDS EST. SOURCE Sinotaia aeruginosa ORGANISM Sinotaia aeruginosa Eukaryota; Metazoa; Spiralia; Lophotrochozoa; Mollusca; Gastropoda; Caenogastropoda; Architaenioglossa; Viviparoidea; Viviparidae; Sinotaia. REFERENCE 1 (bases 1 to 804) AUTHORS An,L.H. and Zheng,B.H. TITLE Construction and Characterization of Normalized cDNA Library from the Snail Bellamya aeruginosa Exposure to Copper JOURNAL Unpublished COMMENT Contact: An L.H. State Environmental Protection Key Laboratory Of Estuarine And Coastal Research Chinese Research Academy For Environment Sciences 8 Dayangfang BeiYuan Road, Chaoyang District, Beijing 100012, China Tel: +86-10-84913914 Fax: +86-10-84913914 Email: anlh@craes.org.cn PCR PRimers FORWARD: CTCGGGAAGCGCGCCATTGTGTTGGT BACKWARD: ATACGTCTCACTATAGGGCGAATTGGCC. FEATURES Location/Qualifiers source 1..804 /organism="Sinotaia aeruginosa" /mol_type="mRNA" /db_xref="taxon:2653872" /tissue_type="gonads; digestive gland; peripheral tissue" /clone_lib="SAMN00622379 Bellamya aeruginosa normalized cDNA library" /dev_stage="mature" /note="Vector: Lambda TripEx2; 1.5 microliter RNA solution (1-3 microgram of total RNA) was normalized using CDS and SMART Oligo IV primer firstly, and then the reaction solution was reversed transcription for synthesizing the first-strand using MMLV reverse transcriptase (Promega, USA). Subsequently, PCR reaction was operated and cDNA was extracted using Promegas PCR clean-up system kit (Madison, USA). And then the cDNA library was constructed using SMART cDNA Library Construction Kit. After that, 6000 random clones were sequenced by the ABI3730xl. BLAST homology searches in the nr and nt databases in GenBank were performed for each of the unigenes under Evalues of 1e-5. The unigenes were named after the homologous sequences in GenBank. The annotated unigenes were then matched to specific processes or functions using COG and GO tools." BASE COUNT 216 a 218 c 210 g 160 t ORIGIN 1 gggtcccggc accatttcct gttacttagc aaccgcgcgg tatctggcaa gatgagactg 61 gaattggctg tgacttttct tgttgttttt gctggacaca aatgccatgc tgactttgat 121 gggcatggat ccaattgaat tgccaccgtc gctacccaag tctctgtact cggcacccag 181 caacaaccag cggcggcagt atcaaatgta tcaacagcag caacggaaca gagttctgct 241 ggaacagcag cagtttgatc agcagaggcg cttgcagcag gaacaattgg cactgaagaa 301 actgcagaac ctcacacaag aagacatgcg caaactggcg gccacactgc cacgtgaacg 361 cctgcagcaa attatcaaca gaatccgcca gctcaagatc ggcaccgctc cggccccgtc 421 gaggtacgac tcacaggtac agaacatgat caattctggt gccaacacca tccgtcgacc 481 gttaggatca cccaacgcca tcaacgccaa aggacaaatg agcaacagca tgatgcagct 541 gcagaggtcg ctcgttcgtg ggatgaccaa cagggctcgc tcaccaggtc aacagctggt 601 gcaaacagtt cagaaatacc ggagcaacac aaagaagatc caagatgcga tggtggcagg 661 gtgcacgtac ccgacaccaa tggggatgga gggaatggaa atggcggcgt tcgcgtttac 721 ctcttgttcg aatcccatga cgtcttcttc ttgtctggct aacggcagat cgtgtgccaa 781 cataggcggc tctagtatgt gctg //