LOCUS       JK034083                 804 bp    mRNA    linear   EST 07-FEB-2014
DEFINITION  1 (LHA-2011) Bellamya aeruginosa normalized cDNA library Bellamya
            aeruginosa cDNA 5', mRNA sequence.
ACCESSION   JK034083
VERSION     JK034083.1
DBLINK      BioSample: SAMN00622379
KEYWORDS    EST.
SOURCE      Sinotaia aeruginosa
  ORGANISM  Sinotaia aeruginosa
            Eukaryota; Metazoa; Spiralia; Lophotrochozoa; Mollusca; Gastropoda;
            Caenogastropoda; Architaenioglossa; Viviparoidea; Viviparidae;
            Sinotaia.
REFERENCE   1  (bases 1 to 804)
  AUTHORS   An,L.H. and Zheng,B.H.
  TITLE     Construction and Characterization of Normalized cDNA Library from
            the Snail Bellamya aeruginosa Exposure to Copper
  JOURNAL   Unpublished
COMMENT     Contact: An L.H.
            State Environmental Protection Key Laboratory Of Estuarine And
            Coastal Research
            Chinese Research Academy For Environment Sciences
            8 Dayangfang BeiYuan Road, Chaoyang District, Beijing 100012, China
            Tel: +86-10-84913914
            Fax: +86-10-84913914
            Email: anlh@craes.org.cn
            PCR PRimers
            FORWARD: CTCGGGAAGCGCGCCATTGTGTTGGT
            BACKWARD: ATACGTCTCACTATAGGGCGAATTGGCC.
FEATURES             Location/Qualifiers
     source          1..804
                     /organism="Sinotaia aeruginosa"
                     /mol_type="mRNA"
                     /db_xref="taxon:2653872"
                     /tissue_type="gonads; digestive gland; peripheral tissue"
                     /clone_lib="SAMN00622379 Bellamya aeruginosa normalized
                     cDNA library"
                     /dev_stage="mature"
                     /note="Vector: Lambda TripEx2; 1.5 microliter RNA solution
                     (1-3 microgram of total RNA) was normalized using CDS and
                     SMART Oligo IV primer firstly, and then the reaction
                     solution was reversed transcription for synthesizing the
                     first-strand using MMLV reverse transcriptase (Promega,
                     USA). Subsequently, PCR reaction was operated and cDNA was
                     extracted using Promegas PCR clean-up system kit (Madison,
                     USA). And then the cDNA library was constructed using
                     SMART cDNA Library Construction Kit. After that, 6000
                     random clones were sequenced by the ABI3730xl. BLAST
                     homology searches in the nr and nt databases in GenBank
                     were performed for each of the unigenes under Evalues of
                     1e-5. The unigenes were named after the homologous
                     sequences in GenBank. The annotated unigenes were then
                     matched to specific processes or functions using COG and
                     GO tools."
BASE COUNT          216 a          218 c          210 g          160 t
ORIGIN      
        1 gggtcccggc accatttcct gttacttagc aaccgcgcgg tatctggcaa gatgagactg
       61 gaattggctg tgacttttct tgttgttttt gctggacaca aatgccatgc tgactttgat
      121 gggcatggat ccaattgaat tgccaccgtc gctacccaag tctctgtact cggcacccag
      181 caacaaccag cggcggcagt atcaaatgta tcaacagcag caacggaaca gagttctgct
      241 ggaacagcag cagtttgatc agcagaggcg cttgcagcag gaacaattgg cactgaagaa
      301 actgcagaac ctcacacaag aagacatgcg caaactggcg gccacactgc cacgtgaacg
      361 cctgcagcaa attatcaaca gaatccgcca gctcaagatc ggcaccgctc cggccccgtc
      421 gaggtacgac tcacaggtac agaacatgat caattctggt gccaacacca tccgtcgacc
      481 gttaggatca cccaacgcca tcaacgccaa aggacaaatg agcaacagca tgatgcagct
      541 gcagaggtcg ctcgttcgtg ggatgaccaa cagggctcgc tcaccaggtc aacagctggt
      601 gcaaacagtt cagaaatacc ggagcaacac aaagaagatc caagatgcga tggtggcagg
      661 gtgcacgtac ccgacaccaa tggggatgga gggaatggaa atggcggcgt tcgcgtttac
      721 ctcttgttcg aatcccatga cgtcttcttc ttgtctggct aacggcagat cgtgtgccaa
      781 cataggcggc tctagtatgt gctg
//