LOCUS       JJ776347                 270 bp    DNA     linear   GSS 03-MAY-2011
DEFINITION  SIL-045H4TV Sisymbrium irio BAC library SIL Sisymbrium irio genomic
            clone SIL-045H4, genomic survey sequence.
ACCESSION   JJ776347
VERSION     JJ776347.1
DBLINK      BioSample: SAMN00262764
KEYWORDS    GSS.
SOURCE      Sisymbrium irio
  ORGANISM  Sisymbrium irio
            Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
            Spermatophyta; Magnoliopsida; eudicotyledons; Gunneridae;
            Pentapetalae; rosids; malvids; Brassicales; Brassicaceae;
            Sisymbrieae; Sisymbrium.
REFERENCE   1  (bases 1 to 270)
  AUTHORS   Town,C.D., Tang,H., Paterson,A.H. and Pires,J.C.
  TITLE     Comparative Genomics of Sisymbrium irio
  JOURNAL   Unpublished
COMMENT     Other_GSSs: SIL-045H4TR
            Contact: Chris D. Town
            Plant Genomics
            J. Craig Venter Institute
            9704 Medical Center Dr., Rockville, MD 20850, USA
            Tel: 301-795-7523
            Fax: 301-795-7070
            Email: cdtown@jcvi.org
            Insert Length: 120000   Std Error: 0.00
            Plate: SIL-045  row: H  column: 4
            Seq primer: T7 Rev 20bp Primer (TAATACGACTCACTATAGGG)
            Class: BAC ends.
FEATURES             Location/Qualifiers
     source          1..270
                     /organism="Sisymbrium irio"
                     /mol_type="genomic DNA"
                     /strain="Gomez-Campo 1146-67"
                     /db_xref="taxon:3730"
                     /clone="SIL-045H4"
                     /clone_lib="SAMN00262764 Sisymbrium irio BAC library SIL"
                     /note="Vector: pCC1BAC; Site_1: HindIII; Constructed by
                     Amplicon Express; Transformed into Invitrogen DH10b phage
                     resistant E. coli."
BASE COUNT           83 a           60 c           34 g           93 t
ORIGIN      
        1 ttgtacccct tctcttttaa ttctaattca ttgtatttct ttttcatatc ttgagctttg
       61 aattctgcat cgacctgtgt acgacttaag tatcagttaa tgaaaagcaa gcaaagtaac
      121 acagcaacga gcaagaaagt tatttgttac cctagatgcc ttcaactcat ccacagactt
      181 tttcagcttc tcataattag actttgcttc agtcaacacc tctttatgtt catcaatcaa
      241 ctgaacaaca acaaaaaaag actgctgttt
//