LOCUS JJ776347 270 bp DNA linear GSS 03-MAY-2011 DEFINITION SIL-045H4TV Sisymbrium irio BAC library SIL Sisymbrium irio genomic clone SIL-045H4, genomic survey sequence. ACCESSION JJ776347 VERSION JJ776347.1 DBLINK BioSample: SAMN00262764 KEYWORDS GSS. SOURCE Sisymbrium irio ORGANISM Sisymbrium irio Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliopsida; eudicotyledons; Gunneridae; Pentapetalae; rosids; malvids; Brassicales; Brassicaceae; Sisymbrieae; Sisymbrium. REFERENCE 1 (bases 1 to 270) AUTHORS Town,C.D., Tang,H., Paterson,A.H. and Pires,J.C. TITLE Comparative Genomics of Sisymbrium irio JOURNAL Unpublished COMMENT Other_GSSs: SIL-045H4TR Contact: Chris D. Town Plant Genomics J. Craig Venter Institute 9704 Medical Center Dr., Rockville, MD 20850, USA Tel: 301-795-7523 Fax: 301-795-7070 Email: cdtown@jcvi.org Insert Length: 120000 Std Error: 0.00 Plate: SIL-045 row: H column: 4 Seq primer: T7 Rev 20bp Primer (TAATACGACTCACTATAGGG) Class: BAC ends. FEATURES Location/Qualifiers source 1..270 /organism="Sisymbrium irio" /mol_type="genomic DNA" /strain="Gomez-Campo 1146-67" /db_xref="taxon:3730" /clone="SIL-045H4" /clone_lib="SAMN00262764 Sisymbrium irio BAC library SIL" /note="Vector: pCC1BAC; Site_1: HindIII; Constructed by Amplicon Express; Transformed into Invitrogen DH10b phage resistant E. coli." BASE COUNT 83 a 60 c 34 g 93 t ORIGIN 1 ttgtacccct tctcttttaa ttctaattca ttgtatttct ttttcatatc ttgagctttg 61 aattctgcat cgacctgtgt acgacttaag tatcagttaa tgaaaagcaa gcaaagtaac 121 acagcaacga gcaagaaagt tatttgttac cctagatgcc ttcaactcat ccacagactt 181 tttcagcttc tcataattag actttgcttc agtcaacacc tctttatgtt catcaatcaa 241 ctgaacaaca acaaaaaaag actgctgttt //