LOCUS JJ776338 224 bp DNA linear GSS 03-MAY-2011 DEFINITION SIL-045L24TV Sisymbrium irio BAC library SIL Sisymbrium irio genomic clone SIL-045L24, genomic survey sequence. ACCESSION JJ776338 VERSION JJ776338.1 DBLINK BioSample: SAMN00262764 KEYWORDS GSS. SOURCE Sisymbrium irio ORGANISM Sisymbrium irio Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliopsida; eudicotyledons; Gunneridae; Pentapetalae; rosids; malvids; Brassicales; Brassicaceae; Sisymbrieae; Sisymbrium. REFERENCE 1 (bases 1 to 224) AUTHORS Town,C.D., Tang,H., Paterson,A.H. and Pires,J.C. TITLE Comparative Genomics of Sisymbrium irio JOURNAL Unpublished COMMENT Other_GSSs: SIL-045L24TR Contact: Chris D. Town Plant Genomics J. Craig Venter Institute 9704 Medical Center Dr., Rockville, MD 20850, USA Tel: 301-795-7523 Fax: 301-795-7070 Email: cdtown@jcvi.org Insert Length: 120000 Std Error: 0.00 Plate: SIL-045 row: L column: 24 Seq primer: T7 Rev 20bp Primer (TAATACGACTCACTATAGGG) Class: BAC ends. FEATURES Location/Qualifiers source 1..224 /organism="Sisymbrium irio" /mol_type="genomic DNA" /strain="Gomez-Campo 1146-67" /db_xref="taxon:3730" /clone="SIL-045L24" /clone_lib="SAMN00262764 Sisymbrium irio BAC library SIL" /note="Vector: pCC1BAC; Site_1: HindIII; Constructed by Amplicon Express; Transformed into Invitrogen DH10b phage resistant E. coli." BASE COUNT 52 a 50 c 57 g 65 t ORIGIN 1 attccctccc ttttcaggag gttttgtcct caaaagtgga tcgtctgcat cacatggaga 61 taagtcagct acattaaagc tgtgggacac tatatacttg catggcaggt ctaggcggta 121 ggcattgtcg ttgatgcgct ccagaaattt aaatgggccg tctcctctgg gtgatagttt 181 ggaaacccgg tcgtttagaa atctctcagg ccgcatgtgt aacc //