LOCUS JJ776305 74 bp DNA linear GSS 03-MAY-2011 DEFINITION SIL-045F2TV Sisymbrium irio BAC library SIL Sisymbrium irio genomic clone SIL-045F2, genomic survey sequence. ACCESSION JJ776305 VERSION JJ776305.1 DBLINK BioSample: SAMN00262764 KEYWORDS GSS. SOURCE Sisymbrium irio ORGANISM Sisymbrium irio Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliopsida; eudicotyledons; Gunneridae; Pentapetalae; rosids; malvids; Brassicales; Brassicaceae; Sisymbrieae; Sisymbrium. REFERENCE 1 (bases 1 to 74) AUTHORS Town,C.D., Tang,H., Paterson,A.H. and Pires,J.C. TITLE Comparative Genomics of Sisymbrium irio JOURNAL Unpublished COMMENT Other_GSSs: SIL-045F2TR Contact: Chris D. Town Plant Genomics J. Craig Venter Institute 9704 Medical Center Dr., Rockville, MD 20850, USA Tel: 301-795-7523 Fax: 301-795-7070 Email: cdtown@jcvi.org Insert Length: 120000 Std Error: 0.00 Plate: SIL-045 row: F column: 2 Seq primer: T7 Rev 20bp Primer (TAATACGACTCACTATAGGG) Class: BAC ends. FEATURES Location/Qualifiers source 1..74 /organism="Sisymbrium irio" /mol_type="genomic DNA" /strain="Gomez-Campo 1146-67" /db_xref="taxon:3730" /clone="SIL-045F2" /clone_lib="SAMN00262764 Sisymbrium irio BAC library SIL" /note="Vector: pCC1BAC; Site_1: HindIII; Constructed by Amplicon Express; Transformed into Invitrogen DH10b phage resistant E. coli." BASE COUNT 13 a 9 c 21 g 31 t ORIGIN 1 atatacacgg ctggggttat tttcagttac ggctgtgtta tttttcagtt acggctgggt 61 tagtatttgg gtta //