LOCUS JJ776296 264 bp DNA linear GSS 03-MAY-2011 DEFINITION SIL-045N8TV Sisymbrium irio BAC library SIL Sisymbrium irio genomic clone SIL-045N8, genomic survey sequence. ACCESSION JJ776296 VERSION JJ776296.1 DBLINK BioSample: SAMN00262764 KEYWORDS GSS. SOURCE Sisymbrium irio ORGANISM Sisymbrium irio Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliopsida; eudicotyledons; Gunneridae; Pentapetalae; rosids; malvids; Brassicales; Brassicaceae; Sisymbrieae; Sisymbrium. REFERENCE 1 (bases 1 to 264) AUTHORS Town,C.D., Tang,H., Paterson,A.H. and Pires,J.C. TITLE Comparative Genomics of Sisymbrium irio JOURNAL Unpublished COMMENT Other_GSSs: SIL-045N8TR Contact: Chris D. Town Plant Genomics J. Craig Venter Institute 9704 Medical Center Dr., Rockville, MD 20850, USA Tel: 301-795-7523 Fax: 301-795-7070 Email: cdtown@jcvi.org Insert Length: 120000 Std Error: 0.00 Plate: SIL-045 row: N column: 8 Seq primer: T7 Rev 20bp Primer (TAATACGACTCACTATAGGG) Class: BAC ends. FEATURES Location/Qualifiers source 1..264 /organism="Sisymbrium irio" /mol_type="genomic DNA" /strain="Gomez-Campo 1146-67" /db_xref="taxon:3730" /clone="SIL-045N8" /clone_lib="SAMN00262764 Sisymbrium irio BAC library SIL" /note="Vector: pCC1BAC; Site_1: HindIII; Constructed by Amplicon Express; Transformed into Invitrogen DH10b phage resistant E. coli." BASE COUNT 88 a 51 c 55 g 70 t ORIGIN 1 atctgtataa tgcaagaatc agcatctgta tattgcaaga atcagcatca tcttaccatt 61 gcacgaacgt tgatttcaaa agctagaatg ttacaaatct tcacttatta acggtgtacg 121 acctcagaac tccatacatg actgacgaga agatcctcct ttacattgac gaagtcagat 181 tggtttgaaa atcccatgag cggtgaagag tacgactgga aaggtttggg atgaagagaa 241 cgtctgccga agttgaacca aatt //