LOCUS       JJ776296                 264 bp    DNA     linear   GSS 03-MAY-2011
DEFINITION  SIL-045N8TV Sisymbrium irio BAC library SIL Sisymbrium irio genomic
            clone SIL-045N8, genomic survey sequence.
ACCESSION   JJ776296
VERSION     JJ776296.1
DBLINK      BioSample: SAMN00262764
KEYWORDS    GSS.
SOURCE      Sisymbrium irio
  ORGANISM  Sisymbrium irio
            Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
            Spermatophyta; Magnoliopsida; eudicotyledons; Gunneridae;
            Pentapetalae; rosids; malvids; Brassicales; Brassicaceae;
            Sisymbrieae; Sisymbrium.
REFERENCE   1  (bases 1 to 264)
  AUTHORS   Town,C.D., Tang,H., Paterson,A.H. and Pires,J.C.
  TITLE     Comparative Genomics of Sisymbrium irio
  JOURNAL   Unpublished
COMMENT     Other_GSSs: SIL-045N8TR
            Contact: Chris D. Town
            Plant Genomics
            J. Craig Venter Institute
            9704 Medical Center Dr., Rockville, MD 20850, USA
            Tel: 301-795-7523
            Fax: 301-795-7070
            Email: cdtown@jcvi.org
            Insert Length: 120000   Std Error: 0.00
            Plate: SIL-045  row: N  column: 8
            Seq primer: T7 Rev 20bp Primer (TAATACGACTCACTATAGGG)
            Class: BAC ends.
FEATURES             Location/Qualifiers
     source          1..264
                     /organism="Sisymbrium irio"
                     /mol_type="genomic DNA"
                     /strain="Gomez-Campo 1146-67"
                     /db_xref="taxon:3730"
                     /clone="SIL-045N8"
                     /clone_lib="SAMN00262764 Sisymbrium irio BAC library SIL"
                     /note="Vector: pCC1BAC; Site_1: HindIII; Constructed by
                     Amplicon Express; Transformed into Invitrogen DH10b phage
                     resistant E. coli."
BASE COUNT           88 a           51 c           55 g           70 t
ORIGIN      
        1 atctgtataa tgcaagaatc agcatctgta tattgcaaga atcagcatca tcttaccatt
       61 gcacgaacgt tgatttcaaa agctagaatg ttacaaatct tcacttatta acggtgtacg
      121 acctcagaac tccatacatg actgacgaga agatcctcct ttacattgac gaagtcagat
      181 tggtttgaaa atcccatgag cggtgaagag tacgactgga aaggtttggg atgaagagaa
      241 cgtctgccga agttgaacca aatt
//